- N-Phosphino- and N-Phosphonionitrilimines: From Nucleophilic to Electrophilic 1,3-Dipoles
-
N-[Bis(diisopropylamino)phosphino]-C-[bis(diisopropylamino) thioxophosphoranyl]nitrilimine (1) reacts with electron-poor dipolarophiles such as maleimide, methyl vinyl ketone, and 1,4-naphthoquinone via HOMO(dipole)-controlled [2+3] cycloadditions, while N-[bis(diisopropylamino)(methyl)phosphonio]-C-[bis(diisopropylamino) thioxophosphoranyl]nitrilimine (2a) reacts with electron-rich dipolarophiles such as norbornadiene and ethyl trans-pyrrolineacrylate via LUMO(dipole)-controlled [2+3] cycloadditions. Carbon disulfide reacts with 1 via a formal [4+2] cycloaddition leading to phosphazene containing heterocycle 11 in 75% yield. Dipole 1 is cleaved by HCl, giving the corresponding (thioxophosphoranyl)diazomethane 15, while addition of HCl to 2a leads to hydrazonoyl chloride 16, in 70% isolated yield. Hydrazone 17′ (95%) and phosphazine 18 (80%) are obtained by a 1,3-addition of BuLi to 1 and PhOLi to 2a, respectively. Trimethylphosphine reacts with 2a by a phosphine - carbene coupling reaction, giving the ylide 20 which is isolated in 75% yield.
- Palacios, Francisco,Pagalday, Jaione,Piquet, Valerie,Dahan, Francoise,Baceiredo, Antoine,Bertrand, Guy
-
-
Read Online
- Synthesis and properties of di-isopropylamino derivatives of diphosphanes and triphosphanes: The x-ray structure of (ipr2n) 2p-p(sime3)2
-
(iPr2N)2PCl (3) reacts with P(SiMe 3)2Li yielding crystalline (iPr2N) 2P-P(SiMe3)2 (1). Compound 1 crystallizes in the orthorhombic space group Pbca. The lithiation of 1 with BuLi yields ( iPr2N)2P-P(SiMe3)Li (2). Compound 2 reacts with 3 with the formation of (iPr2N) 2P-P(SiMe3)-P(NiPr2)2 (4) in high yield. Attempts to lithiate 4 with BuLi in THF solution in order to obtain (iPr2N) 2P-PLi-P(NiPr2) 2were unsuccessful, probably due to strong electron donation of the iPr2N groups into the P-P-P skeleton in 4.
- Domanska-Babul, Wioleta,Baranowska, Katarzyna,Pikies, Jerzy
-
-
Read Online
- BULKY ALKYLS, AMIDES, AND ARYLOXIDES OF MAIN GROUP 5 ELEMENTS. PART 1. PERSISTENT PHOSPHINYL AND ARSINYL RADICALS MRR' AND THEIR CHLOROPRECURSORS MRR'Cl AND RELATED COMPOUNDS
-
Interaction of LiR and MCl3 in appropriate stoicheiometry affords the following new compounds: MCl2 or M2Cl (M = P, As, or Sb), MCl2 or M2Cl (M = As or Sb), or Bi3.Reaction of P(NPri2)Cl2 with Li*OEt2, Li, Li, MgButBr, or NHPri2 yields the corresponding new compound P(NPri2)RCl, while Li with P(NMe2)Cl2 affords P(NMe2)Cl.Reduction of the appropriate phosphorus(III) or arsenic(III) monochloride in toluene by photolysis with the olefin gives the persistent (t1/2 = 3 days to > 1 year in PhMe at 300 K) phosphorus(II) or arsenic(II) alkyl or amide: M2 (M = P or As), M2, P(NR2) (R = Pri or SiMe3), P(NPri2),P2, or P(NPri2).Electron spin resonance parameters are discussed.
- Gynane, Michael J. S.,Hudson, Andrew,Lappert, Michael F.,Power, Philip P.,Goldwhite, Harold
-
-
Read Online
- Total Synthesis of the Congested, Bisphosphorylated Morganella morganii Zwitterionic Trisaccharide Repeating Unit
-
Zwitterionic polysaccharides (ZPSs) activate T-cell-dependent immune responses by major histocompatibility complex class II presentation. Herein, we report the first synthesis of a Morganella morganii ZPS repeating unit as an enabling tool in the synthesis of novel ZPS materials. The repeating unit incorporates a 1,2-cis-α-glycosidic bond; the problematic 1,2-trans-galactosidic bond, Gal-β-(1 → 3)-GalNAc; and phosphoglycerol and phosphocholine residues which have not been previously observed together as functional groups on the same oligosaccharide. The successful third-generation approach leverages a first in class glycosylation of a phosphoglycerol-functionalized acceptor. To install the phosphocholine unit, a highly effective phosphocholine donor was synthesized.
- Keith, D. Jamin,Townsend, Steven D.
-
supporting information
p. 12939 - 12945
(2019/08/22)
-
- Self-neutralizing oligonucleotides with enhanced cellular uptake
-
There is tremendous potential for oligonucleotide (ON) therapeutics, but low cellular penetration due to their polyanionic nature is a major obstacle. We addressed this problem by developing a new approach for ON charge neutralization in which multiple branched charge-neutralizing sleeves (BCNSs) are attached to the internucleoside phosphates of ON by phosphotriester bonds. The BCNSs are terminated with positively charged amino groups, and are optimized to form ion pairs with the neighboring phosphate groups. The new modified ONs can be prepared by standard automated phosphoramidite chemistry in good yield and purity. They possess good solubility and hybridization properties, are not involved in non-standard intramolecular aggregation, have low cytotoxicity, adequate chemical stability, improved serum stability, and above all, display significantly enhanced cellular uptake. Thus, the new ON derivatives exhibit properties that make them promising candidates for the development of novel therapeutics or research tools for modulation of the expression of target genes.
- Yanachkov, Ivan,Zavizion, Boris,Metelev, Valeri,Stevens, Laura J.,Tabatadze, Yekaterina,Yanachkova, Milka,Wright, George,Krichevsky, Anna M.,Tabatadze, David R.
-
p. 1363 - 1380
(2017/02/15)
-
- Stereoselective P-Cyclisation and Diastereoisomeric Purification of 5-Phenyl-3-(pyridin-2-yl)-1,3,2-oxazaphospholidine Formed from a Thermolabile Protecting Group
-
A one-pot, two-step synthesis of 5-phenyl-3-(pyridin-2-yl)-1,3,2-oxazaphospholidine from linear precursor bis(diisopropylamino){2-[(pyridin-2-yl)amino]-1-phenylethoxy}phosphine is achieved using a stereoselective intramolecular cyclisation. Application of a pure enantiomer {1-phenyl-2-[(pyridin-2-yl)amino]ethanol} enabled partial diastereopurification by crystallisation. For all four diastereoisomers, the absolute configuration of the P-centre was determined using X-ray crystallography and correlative 31P NMR data. Stereochemically pure 5a was then used in nucleoside phosphitylation reactions with partial loss of stereopurity by retention of configuration on the phosphorus centre. A one-pot, two-step synthesis of 5-phenyl-3-(pyridin-2-yl)-1,3,2-oxazaphospholidine from linear bis(diisopropylamino){2-[(pyridin-2-yl)amino]-1-phenylethoxy}phosphine by stereoselective intramolecular P-cyclisation is described. For all four diastereoisomers produced, the absolute configuration of the P-centre is determined by X-ray crystallography and correlated with 31P NMR data.
- Kaczyński, Tomasz P.,Manszewski, Tomasz,Chmielewski, Marcin K.
-
p. 2522 - 2527
(2016/06/01)
-
- NEW METHOD OF POLYPHOSPHATE SYNTHESIS
-
The subject of the invention is a new method of the synthesis of polyphosphate analogues, such as nucleosides, oligonucleotides, carbohydrates, peptides and proteins, which are of biological importance and are used in organic chemistry, molecular biology and biotechnology. Polyphosphate analogues, including in particular nucleoside 5'-triphosphates, display high biological activity and are responsible for the provision and storage of energy in live organisms. The method relates to the synthesis of organic polyphosphates of general formula (1), where n has a value of 0 to 2, while X stands for an organic radical, in particular nucleoside, oligonucleotide, peptide-carbohydrate or a protein radical.
- -
-
Page/Page column 13; 14
(2014/03/21)
-
- Solid-phase synthesis of 5′-O-β,γ-methylenetriphosphate derivatives of nucleosides and evaluation of their inhibitory activity against HIV-1 reverse transcriptase
-
Bis(dichlorophosphino)methane was converted to a β,γ-methylenetriphosphitylating reagent. The reagent was immobilized on aminomethyl polystyrene resin-bound linker of 4-acetoxy-3-phenylbenzyl alcohol to afford a polymer-bound β,γ-methylenetriphosphitylating reagent, which was reacted with unprotected nucleosides followed by oxidation with tert-butyl hydroperoxide, deprotection of cyanoethoxy groups with DBU, and acidic cleavage to produce 5′-O-β,γ-methylene triphosphate nucleosides in 53-82% overall yields. Among all the compounds, cytidine 5′-O-β,γ-methylenetriphosphate inhibited completely RNase H activity of HIV-1 reverse transcriptase at 700 μM.
- Ahmadibeni, Yousef,Dash, Chandravanu,Le Grice, Stuart F.J.,Parang, Keykavous
-
supporting information; experimental part
p. 3010 - 3013
(2010/07/10)
-
- Optimized synthesis of phosphatidylserine
-
The synthesis of phosphatidyl serine containing saturated fatty acids was thoroughly studied and optimized in order to establish a protocol amenable to large-scale synthesis. The key step was a one-pot multicomponent reaction involving an O-benzyl phosphorodiamidite, protected serine and diacylglycerol, followed by in situ oxidation of the resulting phosphite. In order to replace expensive and poorly stable tetrazole, a screening of substitutes was carried out and imidazolium chloride was selected as the best suited one. Springer-Verlag 2010.
- Guanti, Giuseppe,Banfi,Basso,Bondanza,Guglieri,Powles,Riva
-
experimental part
p. 367 - 373
(2010/12/18)
-
- Protecting of a thermolabile protecting group: "click-clack" approach
-
Image Presented A new method for attaining higher stability of thermolabile protecting groups (TPG) using an intramolecular cyclization through a "click-clack" approach was demonstrated. It was found that during intramolecular cyclization of 2-pyridyl typ
- Chmielewski, Marcin K.
-
supporting information; experimental part
p. 3742 - 3745
(2011/03/18)
-
- Phosphorus protecting groups
-
In certain embodiments of the invention, novel compositions having a phosphorus group and a phosphorus protecting group bound to the phosphorus group are provided, and methods of deprotecting the phosphorus group are provided.
- -
-
Page/Page column 17
(2008/06/13)
-
- Synthesis and characterization of diaminodithio- and aminotrithiophosphoric acid esters
-
The synthesis and characterization of a series of five new diaminodithiophosphoric acid esters (R1R2N)2P(S)SR and five new aminotrithiophosphoric acid esters (R1R2N)P(S)(SR)2 are described. The structure of two of these compounds, the diaminodithio deriva
- Marchand, Patrice,Meffre, Anca,Donnadieu, Bruno,Taton, Daniel,Gnanou, Yves,Destarac, Mathias,Leising, Frederic,Caminade, Anne-Marie,Majoral, Jean-Pierre
-
p. 1233 - 1244
(2008/02/05)
-
- Solid-phase synthesis of symmetrical 5′,5′-dinucleoside mono-, di-, tri-, and tetraphosphodiesters
-
(Chemical Equation Presented) Four classes of phosphitylating reagents were subjected to reactions with aminomethyl polystyrene resin-bound p-acetoxybenzyl alcohol to yield the corresponding polymer-bound mono-, di-, tri-, and tetraphosphitylating reagents. The solid-phase reagents were reacted with unprotected nucleosides (e.g., thymidine, adenosine, 3′-azido-3′- deoxythymidine, cytidine, or inosine) in the presence of 5-(ethylthio)-1H- tetrazole. Polymer-bound nucleosides underwent oxidation with fert-butyl hydroperoxide, deprotection of cyanoethoxy groups with DBU, and the acidic cleavage, respectively, to afford 5′,5′-dinucleoside mono-, di-, tri-, and tetraphosphodiesters in 59-78% yield.
- Ahmadibeni, Yousef,Parang, Keykavous
-
p. 4483 - 4486
(2008/03/12)
-
- A new mechanism for nucleophilic substitution at a thiophosphoryl centre revealed by the reaction of diisopropylamine with PSCl3
-
The reaction of PSCl3 with Pri2NH at 60 °C affords the disubstitution product (Pri2N) 2P(S)Cl without first forming the monosubstitution product Pr i2NP(S)Cl2/su
- Harger, Martin J. P.
-
p. 2863 - 2865
(2007/10/03)
-
- Phosphinoamidite carboxlates and analogs thereof in the synthesis of oligonucleotides having reduced internucleotide charge
-
Phosphinoamidite carboxylates and analogs are provided that have the structure of formula (I) wherein R1, R2, R3, R4, X, Y, Z and n are as defined herein. The compounds are useful as phosphitylating agents, e.g., in the phosphitylation of 3′ and 5′ hydroxyl groups of nucleosides and oligonucleotides. Also provided are phosphonocarboxylate and H-phosphonite carboxylate analogs of the compounds of formula (I). The compounds enable synthesis of phosphinocarboxylate and phosphonocarboxylate oligonucleotides having reduced internucleotide charge and enhanced nuclease resistance.
- -
-
-
- PROCESS FOR THE PREPARATION OF PHOSPHITYLATION AGENTS
-
A process for the preparation of a compound of formula R1-Y1-P(NR2R3 )2 is provided. The process comprises reacting a compound of formula PX3 with a compound of formula HNR2R3 to form a compound of formula X-P(NR2R3)2; and reacting the compound of formula X-P(NR2R3)2 with a compound of formula R1-Y1-H in the presence of a hydrocarbon solvent to form the compound of formula R1-Y1-P(NR2R3 )2. R1 represents a phosphorus protecting group; R2 and R3 each independently represent an alkyl, preferably a C1-6alkyl, group, or R2 and R3 are joined, together with the N to which they are attached, to form a 5-7 membered ring; Y1 represents O or S, preferably O; and X represents a halogen, preferably Cl. The preferred solvent is toluene.
- -
-
-
- Solid-phase chemical synthesis of phosphonoacetate and thiophosphonoacetate oligodeoxynucleotides
-
Phosphonoacetate and thiophosphonoacetate oligodeoxynucleotides were prepared via a solid-phase synthesis strategy. Under Reformatsky reaction conditions, novel esterified acetic acid phosphinodiamidites were synthesized and condensed with appropriately protected 5′-O-(4, 4′-dimethoxytrityl)-2′-deoxynucleosides to yield 3′-O-phosphinoamidite reactive monomers. These synthons when activated with tetrazole were used with an automated DNA synthesizer to prepare phosphonoacetic acid modified internucleotide linkages on controlled pore glass. The phosphinoacetate coupling products were quantitatively oxidized at each step with (1S)-(+)-(10-camphorsulfonyl)oxaziridine or 3H-1,2-benzodithiol-3-one-1,1-dioxide to produce mixed sequence phosphonoacetate and thiophosphonoacetate oligodeoxynucleotides with an average per cycle coupling efficiency of greater than 97%. Completely deprotected, modified oligodeoxynucleotides were purified by reverse-phase HPLC and characterized by ion exchange HPLC, 31P NMR, and MALDI/TOF mass spectroscopy. Both analogues were stable toward hydrolysis with snake venom phosphodiesterase and stimulated RNase H1 activity.
- Dellinger, Douglas J.,Sheehan, David M.,Christensen, Nanna K.,Lindberg, James G.,Caruthers, Marvin H.
-
p. 940 - 950
(2007/10/03)
-
- Thermolytic Properties of 3-(2-Pyridyl)-1-propyl and 2-[N-Methyl-N-(2-pyridyl)]aminoethyl Phosphate/Thiophosphate Protecting Groups in Solid-Phase Synthesis of Oligodeoxyribonucleotides
-
Thermolytic groups may serve as alternatives to the conventional 2-cyanoethyl group for phosphate/ thiophosphate protection in solid-phase oligonucleotide synthesis to prevent DNA alkylation by acrylonitrile generated under the basic conditions used for oligonucleotide deprotection. Additionally, thermolytic groups are attractive in the context of engineering a "heat-driven" process for the synthesis of oligonucleotides on diagnostic microarrays. In these regards, the potential application of pyridine derivatives as thermolytic phosphate/thiophosphate protecting groups has been investigated. Specifically, 2-pyridinepropanol and 2-[N-methyl-N-(2-pyridyl)]aminoethanol were incorporated into deoxyribonucleoside phosphoramidites 7a-d and 9, which were found as efficient as 2-cyanoethyl deoxyribonucleoside phosphoramidites in solid-phase oligonucleotide synthesis. Whereas the removal of 3-(2-pyridyl)-1-propyl phosphate/thiophosphate protecting groups from oligonucleotides is effected within 30 min upon heating at 55 °C in concentrated NH4OH or in an aqueous buffer at pH 7.0, cleavage of 2-[N-methyl-N-(2-pyridyl)]aminoethyl groups occurs spontaneously when their phosphate or phosphorothioate esters are formed during oligonucleotide synthesis. The deprotection of these groups follows a cyclodeesterification process generating the bicyclic salts 13 and 14 as side products. These salts do not alkylate or otherwise modify any DNA nucleobases and do not desulfurize a phosphorothioate diester model under conditions mimicking large-scale oligonucleotide deprotection.
- Cieslak, Jacek,Beaucage, Serge L.
-
p. 10123 - 10129
(2007/10/03)
-
- The 3-(N-tert-butylcarboxamido)-1-propyl group as an attractive phosphate/thiophosphate protecting group for solid-phase oligodeoxyribonucleotide synthesis
-
Among the various phosphate/thiophosphate protecting groups suitable for solid-phase oligonucleotide synthesis, the 3-(N-tert-butylcarboxamido)-1-propyl group is one of the most convenient, as it can be readily removed, as needed, under thermolytic conditions at neutral pH. The deprotection reaction proceeds rapidly (t1/2 ~ 100 s) through an intramolecular cyclodeesterification reaction involving the amide function and the release of the phosphate/thiophosphate group as a 2-(tertbutylimino)tetrahydrofuran salt. Incorporation of the 3-(N-tert-butylcarboxamido)-1-propyl group into the deoxyribonucleoside phosphoramidites 1a-d is achieved using inexpensive raw materials. The coupling efficiency of 1a-d in the solid-phase synthesis of d(ATCCGTAGCTAAGGTCATGC) and its phosphorothioate analogue is comparable to that of commercial 2-cyanoethyl deoxyribonucleoside phosphoramidites. These oligonucleotides were phosphate/thiophosphate-deprotected within 30 min upon heating at 90 °C in Phosphate-Buffered Saline (PBS buffer, pH 7.2). Since no detectable nucleobase modification or significant phosphorothioate desulfurization occurs, the 3-(N-tert-butylcarboxamido)-1-propyl group represents an attractive alternative to the 2-cyanoethyl group toward the large-scale preparation of therapeutic oligonucleotides.
- Wilk, Andrzej,Chmielewski, Marcin K.,Grajkowski, Andrzej,Phillips, Lawrence R.,Beaucage, Serge L.
-
p. 6430 - 6438
(2007/10/03)
-
- The 4-oxopentyl group as a labile phosphate/thiophosphate protecting group for synthetic oligodeoxyribonucleotides
-
An efficient and economical method for the solid-phase synthesis of oligodeoxyribonucleotides and their phosphorothioate analogues is described. The method entails the use of the 4-oxopentyl group for phosphate/thiophosphate protection. Post-synthesis removal of the protecting group is easily and rapidly achieved under mild conditions at ambient temperature using either pressurized gaseous amines or concentrated ammonium hydroxide.
- Wilk, Andrzej,Chmielewski, Marcin K.,Grajkowski, Andrzej,Phillips, Lawrence R.,Beaucage, Serge L.
-
p. 5635 - 5639
(2007/10/03)
-
- The 2-(N-formyl-N-methyl)aminoethyl group as a potential phosphate/thiophosphate protecting group in solid-phase oligodeoxyribonucleotide synthesis
-
(equation presented) The 2-(N-formyl-N-methyl)aminoethyl deoxyribonucleoside phosphoramidite 1 has been synthesized and used in the solid-phase synthesis of an octadecathymidylic acid as a cost-efficient monomer for potential application in the preparation of therapeutic oligonucleotides. The 2-(N-formyl-N-methyl)aminoethyl group can be cleaved from oligonucleotides according to a unique thermolytic cyclodeesterification process at pH 7.0. In addition to being cost-effective, the use of 1 simplifies oligonucleotide postsynthesis processing by eliminating the utilization of concentrated ammonium hydroxide in oligonucleotide deprotection.
- Grajkowski, Andrzej,Wilk, Andrzej,Chmielewski, Marcin K.,Phillips, Lawrence R.,Beaucage, Serge L.
-
p. 1287 - 1290
(2007/10/03)
-
- An improved method for the preparation of 4-cyano-2-butenyl- deoxyribonucleosidephosphoramidites
-
An improved alternative synthesis of 4-cyano-2-butenyldeoxy nucleosidephosphoramidites in >100g quantities is described via reaction of the phosphordiamidites with 4-cyano-2-buten-1-ol.
- Duckworth,Ackroyd
-
p. 1227 - 1229
(2007/10/03)
-
- Synthetic study of phosphopeptides related to heat shock protein FLSP27
-
Two kinds of phosphoserine-containing peptides related to HSP27 were synthesized by the Boc- or Fmoc-mode solid-phase method based on prephospholylation strategy. In the case of the Boc strategy, the O-phosphono group of the phosphoserine residue was protected with the cyclopentyl or cyclohexyl group. On the other hand, N(x)-Fmoc-O-[(benzyloxy)-hydroxyphosphinyl]serine was employed in case of the Fmoc strategy. Consequently, it has become feasible to utilize conventional solid-phase methods for synthesizing any phosphopeptides which are required to elucidate biochemical significance of protein phosphorylation.
- Wakamiya, Tateaki,Togashi, Ryusaku,Nishida, Takatoshi,Saruta, Kunio,Yasuoka, Jun-Ichi,Kusumoto, Shoichi,Aimoto, Saburo,Kumagaye, Kumiko Yoshizawa,Nakajima, Kiichiro,Nagata, Kazuhiro
-
p. 135 - 145
(2007/10/03)
-
- Synthetic study of lipoteichoic acid of gram positive bacteria. II. Synthesis of the proposed fundamental structure of Enterococcus hirae lipoteichoic acid
-
The proposed fundamental structure of Enterococcus hirae lipoteichoic acid (LTA) was synthesized in order to elucidate the chemical structure responsible for the cytokine-inducing activity described for the natural LTA fraction of this bacteria. Synthesis was accomplished by coupling of the glycolipid part with the poly(glycerol phosphate) (PGP) part by using a phosphoramidite method. The glycolipid part was constructed by coupling of the phosphatidic acid moiety with a kojibiosyl diacylglycerol which had been prepared by stepwise glycosidation with glycosyl fluorides. α-Selective glucosidations were effected by virtue of the 2,2,2-trichloroethoxycarbonyl (Troc) group introduced at the 6-hydroxyl function. p-Nitrobenzyl (NPM) and p-pivaloylaminobenzyl (PAB) groups were successfully applied to temporary protection of hydroxyl functions.
- Fukase,Yoshimura,Kotani,Kusumoto
-
p. 473 - 482
(2007/10/02)
-
- Synthesis and reactivity of diazomethylenephosphoranes ()
-
Several diazomethylenephosphoranes 2 have been synthesized by oxidative ylidation of C-unsubstituted or C-silylated α-diazophosphanes 1 with carbon tetrachloride or tetrabromide.The reactivity of these species as 1,3-dipoles with alkenes, alkynes, and cum
- Sotiropoulos, J. M.,Baceiredo, A.,Bertrand, G.
-
p. 367 - 375
(2007/10/02)
-
- Versatile behavior of hydrido monometallic or heterobimetallic carbonyl anions toward dichlorophosphines and 1,1-dichlorodiphosphines
-
The reactivity of 1,1-dichlorodiphosphine (i-Pr2N)2P-PCl2 (5) toward [NEt4][HW(CO)5] (2) and [NEt4][HFe(CO)4] (1b) has been investigated. The first reaction leads to the neutral difunctionalized diphosphine complex (i-Pr2N)P(Cl)-P(H)(N-i-Pr2)W(CO)5 (9), implying diisopropylamino group migration, while the second reaction affords [NEt4][(i-Pr2N)P(H)[Fe(CO)4]-P(H)[Fe(CO) 4]2] (10) in which a phosphorus-nitrogen bond has been cleaved. The structures of 9 and 10 have been determined by X-ray diffraction. 9 is triclinic, space group P1, with a = 9.887 (4) ?, b = 10.349 (4) ?, c =14.309 (4) ?, α = 75.92 (3)°, β = 75.50 (3)°, γ = 64.72°, and Z = 2. The structure has been solved and refined to R and Rw values of 0.028 and 0.027, respectively, by using 3898 reflections. 10 is monoclinic, space group P21/n, with a = 10.018 (5) ?, b = 29.892 (13) ?, c = 12.337 (5) ?, β = 100.66 (4)°, and Z = 4. The structure has been refined to R and Rw values of 0.086 and 0.081, respectively, by using 2644 reflections. The reaction of dichlorophosphines RPCl2 with [PPh4][HFeW(CO)9] (3) has also been examined: the [PPh4][μ-RP-(Cl)[Fe(CO)4][W(CO)5]] complexes have been obtained (R = Ph, 14a; R = Me, 14b; R = 2,5-dimethyl-1,2,3-σ2-diazaphosphole, 14c). The formation of [PPh4][PhP(H)[Fe(CO)4][W(CO)5]] (15a) from PhPCl2W(CO)5 and [PPh4] [HFe(CO)4] (1a), which requires 2 equiv of the iron anion, points out the specificity of the reaction of 3.
- Westermann, Hermann,Nieger, Martin,Niecke, Edgar,Majoral, Jean-Pierre,Caminade, Anne-Marie,Mathieu, René,Irmer, Erhard
-
p. 244 - 249
(2008/10/08)
-
- New Approach to the Synthesis of Deoxyribonucleoside Phosphoramidite Derivatives
-
The deoxyribonucleoside phosphoramidites with various protecting groups at phosphorus have been prepared rapidly in good yields in one-pot reaction from bis(diisopropylamino)chlorophosphine as a new phosphitylating agent without isolation of bis(diisopropylamino)alkoxyphosphines.
- Hamamoto, Shoji,Takaku, Hiroshi
-
p. 1401 - 1404
(2007/10/02)
-
- Bis(dialkylamino)phosphines
-
Reactions of LiAlH4 with sufficiently sterically hindered (R2N)2PCl derivatives (R = isopropyl and ethyl but not methyl) in diethylether give the corresponding (R2N)2PH derivatives as air-sensitive, vacuum-destillable liquids.Analogous reactions of LiAlH4 with sufficiently sterically hindered heterocycles (CH2)n(NR)2PCl (R = tert-butyl, n = 2 and 3; R not methyl, n not 2) give the corresponding heterocyclic PH derivatives (CH2)n(NR)2PH.The dialkylamino groups in (R2N)2PH undergo successive alcoholysis with the alcohols R'OH (R' = methyl, ethyl, isopropyl, andtert-butyl) to form (R2N)(R'O)PH and (R'O)2PH derivatives, which are identified by their phosphorus-31 NMR spectra.The derivatives (R2N)(R'O)PH (R = isopropyl; R'= methyl, ethyl, isopropyl, and tert-butyl) can be isolated by vacuum distillation as air-sensitive liquids, but the derivatives (R'O)2PH generally decompose upon attempted vacuum distillation.The (R2N)2PH derivatives undergo base-catalyzed addition to (R2N)2PCH=CH2 to give the corresponding diphosphines (R2N)2PCH2CH2P(NR2)2, provided that the R2N groups are not too bulky .The mass spectra and NMR spectra of the new organophosphorus compounds are described.
- King, R.B.,Sundaram, P.M.
-
p. 1784 - 1789
(2007/10/02)
-