Improved Synthesis and Mutagenicity of Oligonucleotides
FULL PAPER
for 3 h at 378C. Addition of buffer F (12 mL, 500 mm Tris-HCl, 1 mm
EDTA), antarctic phosphatase (10 units), snake venom phosphodiester-
ase I (0.2 units, Crotalus adamanteus venom) and incubation for further
3 h at 378C completed the digestion. The supernatant was removed, the
volume reduced to 100 mL and measured with HPLC-ESI-MS.
a polymerase acting on the fC base but by molecular struc-
tures that are formed due to the in vivo action of either
base- or nucleotide excision repair acting on the modifica-
tions. Indeed, it was recently shown that fC and caC are se-
lectively excised by the enzyme TDG, which would generate
an abasic site.[8a,9b] In summary, our data show that fC and
caC are non-mutagenic and therefore can be involved in ep-
igenetic programming of cells without disturbing the genetic
sequence information.
HPLC-ESI-MS: The samples (100 mL injection volume) were analyzed
by HPLC-ESI-MS on a Thermo Finnigan LTQ Orbitrap XL and were
chromatographed by a Dionex Ultimate 3000 HPLC system using gradi-
ent of 2 mm ammonium format in water and 80% acetonitrile over an
Uptisphere120–3HDO column from Interchim.
Melting points: Melting profiles were measured on a Jasco V-650 spectro-
photometer using quartz glass cuvettes with 1 cm path length. In these
were in a total volume of 1 mL: 1 mmol ODN, 1 mm counterstrand,
150 mm NaCl and 10 mm Tris pH: 7.4. First, the oligonucleotides were hy-
bridized by slowly cooling the samples down from 808C to 208C. The
melting profiles started with a denaturing run (20 to 808C) with a slope
of 0.58CminÀ1. At least two denaturing and two renaturing ramps were
performed and averaged for evaluation of the melting point. (TM =zero-
crossing of second derivative of the 400 nm-background corrected change
in hyperchromicity at 260 nm.) For analysis of the data, the program
Origin (Microcal) was used.
Experimental Section
General remarks: Chemicals and solvents were purchased from ABCR,
Alfa Aesar, Acros, Fluka, Sigma–Aldrich or TCI in the qualities puriss.,
p.a. or purum. Dry solvents (<50 ppm H2O) were obtained from Fluka
and Acros. All reactions employing dry solvents were performed under
inert atmosphere (N2). Technical grade solvents were distilled prior to
use for column chromatography and liquid–liquid extractions on a rotary
evaporator (Heidolph Laborota 4000). Reaction products were dried at
high vacuum (0.1 mbar). Aqueous solutions were concentrated on a
SpeedVac plus CS110 A or SPD 111V from Savant or lyophilized (Christ
ALPHA 2-4). Thin layer chromatography (TLC) was performed with
aluminium plates (silica gel 60 F254, 10ꢂ5 cm). Substances were visual-
ized by illumination with UV light (l=254 nm). ESI-MS was performed
on a Finnigan LTQ FTICR. MALDI-TOF was performed on a Bruker
Autoflex II. NMR spectra were recorded on the following spectrometers:
Varian Oxford 200, Bruker AC 300, Varian XL 400 and Bruker AMX
600. The chemical shifts (d) are given in ppm, the coupling constants (J)
in Hz. Exonuclease-deficient DNA polymerase I from E. coli (Klenow
exoÀ) was obtained from NEB, Pol h was purified as described before[26]
and Pol k was cloned from human cDNA and expressed in Rosetta 2
(DE3) cells.
Pyrosequencing analysis: A 37 mer template DNA strand (ODN 2: 5’-
d(GTA GCC AGG TCG CAC GCG TGC TAX GAT GCG AGA
CTG C)-3’ was prepared containing either dC, mC, hmC, fC, caC, or
4-NHOHdC, or dT at position X. 10 pmol of the template were hybridized
with a biotinylated primer (ODN 4: 5’-d(biotin-GCAGTCTCGCATC)-3’,
Metabion). Subsequently, the primer extension experiments were per-
formed with the exonuclease deficient DNA polymerase I from E. coli
(Klenow exoÀ), Pol h and Pol k. The polymerases (1 U Klenow exoÀ,
1 mm Pol h, or 0.5 mm Pol k), 50 mm dNTPs and 0.5 mm dsDNA were incu-
bated in a total volume of 20 mL 1ꢂ NEBuffer 2 for 30 min at different
temperatures (308C for Pol h, 378C for Klenow exoÀ and Pol k). To this
solution 2 mL streptavidin sepharose beads (GE Healthcare, Uppsala,
Sweden), 40 mL binding buffer (Qiagen, Hilden, Germany) and 18 mL
ddH2O were added. After agitation at 1400 rpm for 15 min the beads
were captured with a Vacuum Prep Tool (Qiagen, Hilden, Germany),
washed with 70% EtOH, 0.1m NaOH and Washing Buffer (Qiagen,
Hilden, Germany). The beads were dissolved in 25 mL Annealing Buffer
(Qiagen, Hilden, Germany) containing 5 pmol sequencing primer ODN5
(5’-d(GTAGCCAGGTCGCACGCGTGCTA)-3’, Metabion, Martinsried,
Germany). Pyrosequencing was performed on a PyroMark Q24 Pyrose-
quencer using standard conditions (Qiagen, Hilden, Germany). The data
was analyzed by the software provided by the manufacturer. Peak heights
were exported to Microsoft Excel and the average of all blank sites for
the individual nucleobases calculated. This resulted in one blank for dT,
one blank for dC, one blank for dG and one blank for dA. This value
was subtracted from the values for the incorporation of the individual tri-
phosphates. With these data the relative incorporation at every variable
position was calculated. The data are the average of three measurements.
Oligonucleotide synthesis and deprotection: DNA synthesis was per-
formed on an Expedite 8909 Nucleic Acid Synthesis System (PerSeptive
Biosystems) or an ABI 394 DNA/RNA synthesizer (Applied Biosystems)
using standard DNA synthesis conditions. Phosphoramidites for dA, dC,
dG, dT and CPG carriers were obtained from Amersham, Glen Research
or PE Biosystems. The hmC and fC phosphoramidites were dissolved in
dry MeCN, the caC phosphoramidite in dry toluene. The oligonucleotides
were removed from the resin under concomitant cleavage of the standard
nucleobase protecting groups by treatment with 750 mL conc. NH3 and
250 mL ethanol at room temperature for 18 h (fC) or treatment with 0.4m
NaOH in water/methanol 1:4. Subsequently, the solution was decanted
from the resin. When the deprotection was carried out with NaOH, a 1m
TEA/AcOH solution (600 mL) was added and the solution concentrated
to a final volume of 750 mL. After deprotection with NH4OH the solution
was concentrated to dryness and subsequently taken up in water. Please
note that deprotection with NaOH is not compatible with DMF protect-
ing groups.
Recrystallization: Single crystals, suitable for X-ray diffraction, were ob-
tained by very slow evaporation of the solvent of a fC solution in metha-
nol. The crystals were introduced into perfluorinated oil and a suitable
single crystal was carefully mounted on the top of a thin glass wire. Data
collection was performed with an Oxford Xcalibur 3 diffractometer
equipped with a Spellman generator (50 kV, 40 mA) and a Kappa CCD
detector, operating with MoKa radiation (l=0.71071 ꢃ). Data collection
was performed with the CrysAlis CCD software;[27] CrysAlis RED soft-
ware[27] was used for data reduction. Absorption correction using the
SCALE3 ABSPACK multiscan method[28] was applied. The structures
were solved with SHELXS-97,[29] refined with SHELXL-97[30] and finally
checked using PLATON.[31] All hydrogen atoms involved in hydrogen
bonding were found in the differential Fourier map and refined. Details
for data collection and structure refinement are summarized in Table S4.
HPLC and cleavage of DMT groups: Purification and analysis of ODNs
was performed on a Waters system (Alliance 2695 with PDA 2996; prep-
arative HPLC: 1525EF with 2484 UV detector) with VP 250/10 Nucleosil
100-7 C18 and VP 250/4 Nucleosil 20-3 C18 columns from Macherey–
Nagel using a gradient of 0.1m triethylamine/acetic acid in water and
80% acetonitrile. The oligonucleotides still containing the trityl group
were deprotected by addition of 100 mL of an 80% acetic acid solution.
After incubation at RT for 20 min, 100 mL of water together with 60 mL
of a 3m solution of sodium acetate were added. Finally, the ODN was
precipitated by the addition of 1600 mL ethanol at À208C (30 min). The
strands were stored in ddH2O.
Enzymatic digestion: For the enzymatic digestion DNA mixtures (4 to
10 mg in a final volume of 100 mL H2O) were heated to 1008C for 5 min
to denature the DNA and rapidly cooled on ice. Buffer E (10 mL, 300 mm
ammonium acetate, 100 mm CaCl2, 1 mm ZnSO4, pH 5.7) and nuclease S1
(80 units, Aspergillus oryzae) were added to the mixture and incubated
CCDC 843055 contains the supplementary crystallographic data for this
paper. The data can be obtained free of charge from The Cambridge
Chem. Eur. J. 2011, 17, 13782 – 13788
ꢁ 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
13787