energy transfer (RET) at distances approximating the Fo¨rster
distance, R0 ) 39 Å.12 However, in CFO 1, the short distance
between donor and acceptor, as well as the high quenching
efficiency, strongly suggests a contact-mediated quenching
mechanism.13
melting temperature virtually identical to its cognate 2.
Incorporation of both PC-DABSYL- and fluorescein-modi-
fied deoxycytidines into the middle of 1 produced the lowest
Tm, 66 °C. This represents a 9 °C destabilization relative to
the native duplex, 6-Tg.
Caged oligodeoxynucleotides 1 and 3 (Table 1) were
Association between fluorescein and DABSYL appears
to stabilize the 1-Tg duplex, causing the Tm to increase by
only 1 °C upon photocleavage of the DABSYL moiety: Tm
) 66.0 °C for 1-Tg vs 66.8 °C for photolyzed 1-Tg and
67.3 °C for 2-Tg. Such stabilization may occur through
hydrogen bonding or hydrophobic interactions, as has been
seen previously for other fluorophore-quencher pairs.13 Thus,
future efforts to prevent DNA hybridization with blocking
groups must consider the position and number of photo-
cleavable moieties on the oligonucleotide, in addition to their
hydrophobicity and charge.
Table 1. Oligodeoxynucleotides with Melting Temperatures
sequence (5′ f 3′)a
Tm
Tm postb
1
2
3
4
5
6
ATCCACAGCAGCZYCTCCATCATCC 66.0 (0.2) 66.8 (0.3)
ATCCACAGCAGCXYCTCCATCATCC 67.3 (0.2)
ATCCACAGCAGCZCCTCCATCATCC 69.4 (0.5) 74.2 (0.2)
ATCCACAGCAGCYCCTCCATCATCC 69.1 (0.2)
ATCCACAGCAGCXCCTCCATCATCC 74.6 (0.3)
ATCCACAGCAGCCCCTCCATCATCC 75.1 (0.4)
The pendant aminoethyl group on deoxycytidine has
remarkably little effect on the hybridization energy: compare
5-Tg and 6-Tg (∆Tm ) -0.5 °C). Collectively, the data from
Table 1 suggest that the PC-DABSYL group and resulting
amino-linked photochemical product have little effect on
DNA duplex structure. Because only subtle structural
changes occur at the DNA backbone and the large DABSYL
moiety occupies the major groove, this linker and leaving
group provide an attractive route for modulating the binding
of many proteins. Experiments directed along these lines are
currently underway.
Tg GGATGATGGAGGGGCTGCTGTGGAT
a Modified nucleosides in bold; X, aminolinked dC; Y, fluoresceinated
aminolinked dC; Z, PC-DABSYL aminolinked dC. b Tm measured after
complete photocleavage of PC-DABSYL. Uncertainties in parentheses.
synthesized by first incorporating 2-aminoethyl deoxycytidine
into the oligonucleotide, and, after solid-phase synthesis,
subsequently attaching the photocleavable DABSYL unit.
The aminolinked dC provides a convergent strategy for
attaching a variety of electrophiles under mild conditions,14
as the final step in CFO synthesis. The photolabile DABSYL
unit was covalently attached to the amine under mild
conditions in 50-54% yield. Yields were further improved
by increasing the duration of the reaction, and unreacted
oligonucleotide was readily recovered by HPLC. The CFO
synthesis serves as a mild alternative to the convertible
nucleoside approach for modifying bases in the middle of a
synthetic oligodeoxynucleotide.15 We believe that this cur-
rently offers the best route for incorporating photolabile
leaving groups into the middle of a synthetic oligodeoxy-
nucleotide.
The ability to photoactivate CFOs on the seconds-to-
minute time scale is well suited for many in ViVo applications,
since it minimizes damage to the biological sample and
maximizes spatial and temporal resolution. On the basis of
UV-vis spectra, roughly 60% of the absorbed light between
340 and 360 nm in CFO 1 is due to absorption by the
2-nitrophenyl PC linker, with DABSYL and fluorescein
making much smaller contributions. Our results show that
this is sufficient for quantitative photocleavage of the PC
linker, and activation can be monitored by fluorescence both
in Vitro and in ViVo.
In B-DNA, the non-base-paired substituent on the N4-
position of dC extends into the center of the major groove.
Thus, the modifications to dC were expected to show only
a modest steric effect in duplex formation to the target 25-
mer chordin sequence, Tg. Oligodeoxynucleotides with PC-
DABSYL-modified dC, 3, and fluorescein-modified dC, 4,
exhibited melting temperatures 6 °C lower than unmodified
6 in complexes with Tg. This destabilization energy is
comparable to most single-site mismatches and single-base
modifications observed in DNA duplexes.4,15 Photolysis of
3 for 5 min at 355 nm to generate 5 produced the expected
increase in melting termperature: Tm ) 74.2 °C for photo-
lyzed 3 vs 74.6 °C for 5. Irradiation of 1 also yielded a
CFO 1 is stable in ambient light over several minutes,
which facilitates its synthesis and handling. This compound
was microinjected into living zebrafish embryos while
illuminated with a standard light microscope; no apparent
increase in fluorescence was observed even 24 h later,
indicating that the DABSYL moiety remained intact until
irradiated with UV light. Complete uncaging of 1 was
achieved in living zebrafish embryos within milliseconds
using a UV ion laser (Coherent II, 351 nm, 80 mW) and
inverted confocal microscope. However, the in ViVo fluo-
rescence intensity proved to be difficult to quantify, due to
concomitant photobleaching at high laser power. Addition-
ally, the attenuated fluorescence of CFO 1 made it impossible
to localize the oligonucleotide within the embryo prior to
photolysis.
(12) Stryer, L. Annu. ReV. Biochem. 1978, 47, 819-846.
(13) Marras, S. A. E.; Kramer, F. R.; Tyagi, S. Nucleic Acids Res. 2002,
30, e122.
(14) (a) Markiewicz, W. T.; Groeger, G.; Roesch, R.; Zebrowska, A.;
Markiewicz, M.; Klotz, M.; Hinz, M.; Godzina, P.; Seliger, H. Nucl. Acids.
Res. 1997, 25, 3672-3680. (b) Pieles, U.; Sproat, B. S.; Lamm, G. M.
Nucl. Acids. Res. 1990, 18, 4355-4360.
(15) MacMillan, A. M.; Verdine, G. L. J. Org. Chem. 1990, 55, 5931-
5933.
However, photoactivation of CFO 1 with a low-power UV
lamp identified regions within the embryo that had incor-
porated the compound 24 h postfertilization (Figure 3).
Confocal laser scanning microscopy using a 32 anode
photomultiplier tube for fluorescence detection (Zeiss 510
Org. Lett., Vol. 7, No. 2, 2005
281