Design and synthesis of small-molecule fluorescent photoprobes targeted to aminopeptdase N (APN/CD13) for optical imaging of angiogenesis

Article abstract of DOI:10.1021/bc400074w

We report here the synthesis of a nonpeptide, small-molecule fluorescent imaging agent with high affinity to aminopeptidase N (APN/CD13), a key player in a variety of pathophysiological angiogenic processes. On the basis of a recently described lead structure, we synthesized three putative precursor compounds by introducing polyethylene glycol (PEG) spacers comprising amino groups for dye labeling. Different attachment sites resulted in substantial differences in target affinity, cell toxicity, and target imaging performance. In comparison to bestatin, a natural inhibitor of many aminopeptidases, two of our compounds (22, 23) exhibit comparable inhibition potency, while a third (21) does not show any inhibiting effect. Cell binding assays with APN-positive BT-549 and APN-negative BT-20 cells and the final fluorescent probes Cy 5.5-21 and Cy 5.5-23 confirm these findings. The favorable characteristics of Cy 5.5-23 will now be proven in in vivo experiments with murine models of high APN expression and may serve as a tool to better understand APN pathophysiology.

Full text of DOI:10.1021/bc400074w

Article
pubs.acs.org/bc
Design and Synthesis of Small-Molecule Fluorescent Photoprobes
Targeted to Aminopeptdase N (APN/CD13) for Optical Imaging of
Angiogenesis
Anke Hahnenkamp,† Michael Schafers,‡,§ Christoph Bremer,†,§ and Carsten Holtke*,†
̈
̈
†Department of Clinical Radiology, Albert-Schweitzer-Campus 1/A16, University Hospital Muenster, D-48149 Muenster, Germany
‡European Institute of Molecular Imaging, Mendelstrasse 11, University of Muenster, D-48149 Muenster, Germany
§Interdisciplinary Center of Clinical Research, University of Muenster, D-48149 Muenster, Germany
ABSTRACT: We report here the synthesis of a nonpeptide, small-molecule fluorescent imaging agent with high affinity to
aminopeptidase N (APN/CD13), a key player in a variety of pathophysiological angiogenic processes. On the basis of a recently
described lead structure, we synthesized three putative precursor compounds by introducing polyethylene glycol (PEG) spacers
comprising amino groups for dye labeling. Different attachment sites resulted in substantial differences in target affinity, cell
toxicity, and target imaging performance. In comparison to bestatin, a natural inhibitor of many aminopeptidases, two of our
compounds (22, 23) exhibit comparable inhibition potency, while a third (21) does not show any inhibiting effect. Cell binding
assays with APN-positive BT-549 and APN-negative BT-20 cells and the final fluorescent probes Cy 5.5-21 and Cy 5.5-23
confirm these findings. The favorable characteristics of Cy 5.5-23 will now be proven in in vivo experiments with murine models
of high APN expression and may serve as a tool to better understand APN pathophysiology.
APN exhibits a high affinity to peptides containing the amino
acid motif asparagine−glycine−arginine (NGR), and recently,
we were able to show that a cyclic NGR-containing peptide
conjugated to the cyanine dye Cy 5.5 is capable of delineating
APN expression in vivo using optical imaging techniques.16 In
contrast to peptides, synthetic compounds have the advantage
of a higher bioavailability and a higher in vivo stability.
Approaches toward peptidomimetics as ligands for APN aim at
compounds that bind to the catalytic Zn2+ ion. Typical
functional groups for chelating a doubly charged cation are
e.g. hydroxamate, carboxylate, sulfhydryl, etc.
INTRODUCTION
■
Angiogenesis is a key factor in many pathophysiological
processes such as tumor growth and formation of metastasis,
myocardial remodeling after infarction, as well as diabetes or
arthritis, where it is mainly triggered by the dysregulated release
of growth factors, by hypoxia or by inflammation.1,2 In addition
to angiogenic signaling, tumor growth and progression needs
extracellular proteases to degrade the surrounding extracellular
matrix (ECM) and enable the sprouting of new vessels.
Aminopeptidase N (CD13/APN) is a zinc-dependent
ectoenzyme located in the outer cell membranes of various
cell types. APN is mainly found on epithelial cells of the small
intestine and the kidneys, where it is involved in digestive and
regulative processes,3,4 but APN has also been found
upregulated in a number of human tumors, including ovarian
cancer,5,6 prostate cancer,7,8 renal cell carcinoma,9,10 and
thyroid cancer,11,12 where it was identified as an important
mediator of tumor angiogenesis promoting progression,
metastasis, and tumor cell survival.13−15 Thus, APN could
potentially serve as an attractive target for tumor imaging as
well as targeted therapies.
In this paper, we describe for the first time the synthesis of a
nonpeptidic trans-4-amino-L-proline derivative conjugated to a
fluorescent dye that can be exploited for noninvasive imaging of
APN expression.
Received: February 6, 2013
Revised: April 24, 2013
© XXXX American Chemical Society
A
dx.doi.org/10.1021/bc400074w | Bioconjugate Chem. XXXX, XXX, XXX−XXX

Bioconjugate Chemistry
Article
recorded data was processed by the ChromGate HPLC
software (Knauer).
MATERIALS AND METHODS
■
General. All chemicals, reagents and solvents for the
synthesis of the compounds were analytical grade and
purchased from commercial sources. trans-4-Amino-N-Boc-L-
proline methyl ester hydrochloride (6) was purchased from
Alfa Aesar (Karlsruhe, Germany), bestatin, ferulic acid (1),
syringic acid (2), 3,4-dimethoxycinnamic acid (7), and 3,4-
methylenedioxycinnamic acid (8) were from Sigma-Aldrich
(Schnelldorf, Germany), 2-(2-(2-(2-azidoethoxy)ethoxy)-
ethoxy)ethyl methane sulfonate was synthesized according to
literature procedures,17 and lead compound I2 (Figure 1) was
Ferulic Acid Ethyl Ester. Ferulic acid (1) (19.4 g, 100 mmol)
was dissolved in 350 mL of ethanol and treated with 30 mL
(400 mmol) of thionyl chloride at 0 °C. After stirring overnight
at room temperature, the solvent and excess thionyl chloride
were removed by evaporation. Ethyl acetate was added, and the
organic phase was washed with water (3 × 100 mL) and brine
and dried over MgSO4. Filtration and evaporation of the
solvent yields 20.1 g (90.5 mmol, 90%) of the desired ester. 1H
NMR (CDCl3, 300 MHz) δ = 7.61 (d, J = 16.1 Hz, 1H), 7.10−
7.01 (m, 2H), 6.90 (d, J = 8.4 Hz, 1H), 6.29 (d, J = 16.1 Hz,
1H), 6.03 (br, 1H), 4.26 (q, J = 7.1 Hz, 2H), 3.92 (s, 3H), 1.33
(t, J = 7.1 Hz, 3H) ppm. 13C NMR (CDCl3, 75 MHz) δ =
167.4, 147.9, 146.8, 144.8, 126.9, 123.1, 115.6, 114.8, 109.3,
60.4, 55.9, 14.4 ppm.
(E)-3-(4-(2-(2-(2-(2-Azidoethoxy)ethoxy)ethoxy)ethoxy)-3-
methoxyphenyl)acrylic Acid Ethyl Ester. To a solution of
ferulic acid ethyl ester (2.85 g, 12.8 mmol) in 50 mL of DMF
was added Cs2CO3 (6.51 g, 20.0 mmol) and 2-(2-(2-(2-
azidoethoxy)ethoxy)ethoxy)ethyl methane sulfonate (4.16 g,
14.0 mmol). The mixture was heated to 80 °C overnight,
cooled, and poured into water. After extraction with ethyl
acetate, the combined organic fractions are washed with brine
and dried over MgSO4. Filtration and evaporation of the
solvent yielded 5.95 g (12.0 mmol, 94%) of the desired PEG
1
derivative. H NMR (CDCl3, 300 MHz) δ = 7.62 (d, J = 15.9
Hz, 1H), 7.10−7.03 (m, 2H), 6.90 (d, J = 7.8 Hz, 1H), 6.31 (d,
J = 15.9 Hz, 1H), 4.39−4.36 (m, 2H), 4.25 (q, J = 7.5 Hz, 2H),
4.21 (t, J = 5.5 Hz, 2H), 3.90 (t, J = 5.5 Hz, 2H), 3.88 (s, 3H),
3.74−3.72 (m, 2H), 3.69−3.64 (m, 6H), 3.41−3.36 (m, 2H),
1.33 (t, J = 7.5 Hz, 3H) ppm. 13C NMR (CDCl3, 75 MHz) δ =
167.2, 150.4, 149.6, 144.5, 127.8, 122.4, 116.0, 113.1, 110.2,
70.9, 70.7, 70.6, 70.5, 70.0, 69.5, 68.4, 60.4, 55.9, 50.7, 14.3
ppm.
Figure 1. Benzoyl-aminoproline derivatives (I1−I3) introduced by Xu
and Li in 2005 and the reported inhibition values. I1 and I2 contain
caproic and dimethoxycinnamic acid amides, respectively, and a
hydroxamic acid functional group, while I3 contains a caffeic acid
amide and a carboxylic ester functional group. All compounds are
described to possess a high affinity to APN. We chose I2 with an IC50
value of 2.1 nM as lead structure for further modification.
(E)-3-(4-(2-(2-(2-(2-Azidoethoxy)ethoxy)ethoxy)ethoxy)-3-
methoxyphenyl)acrylic Acid 2. An amount of 10.5 g (25.0
mmol) of the above ester was dissolved in a 3:1:1 mixture of
THF/MeOH/water (250 mL). Lithium hydroxide (2.5 g 100
mmol) was added, and the mixture was stirred for 5 h at room
temperature. The solvent was removed by evaporation and the
residue taken up in water and acidified with 2.5 M HCl.
Extraction with chloroform yielded a crude waxy solid which
was purified by flash column chromatography (cyclohexane/
synthesized as reported.18 1H NMR and 13C NMR spectra were
recorded on a Bruker ARX 300 or an AMX 400 (Bruker
BioSpin GmbH, Rheinstetten, Germany), respectively. Major
and minor signals from rotational isomers are given if an
assignment was possible. Mass spectrometry was performed
using a Bruker MALDI-TOF-MS Reflex IV (matrix: DHB,
Bruker Daltonics GmbH, Bremen, Germany) or a QUATTRO
LCZ (Waters Micromass, Manchester, UK) spectrometer with
a nanospray capillary inlet. HPLC-purification was performed
on a gradient RP-HPLC using a Knauer system with two K-
1800 pumps, an S-2500 UV detector (Herbert Knauer GmbH,
Berlin, Germany), and a RP-HPLC Nucleosil 100−5 C18
column (250 mm × 8.0 mm). Hydroxamic acid derivatives
were purified as follows: λ = 254 nm; flow = 5.5 mL/min;
eluents: A, water for injection/trifluoroacetic acid (TFA) 1000/
1 (v/v); B, acetonitrile/TFA 1000/1 (v/v); elution gradient,
85% A for 1 min, from 85% to 15% A in 20 min, 15% A for 2
min, from 15% to 85% A in 1 min. The following conditions
were used for purifying the fluorescently labeled derivatives:
elution gradient, 95% A for 2 min, from 95% to 35% A in 18
min, 35% A for 1 min, from 35% to 95% A in 1 min. The
1
ethyl acetate 1:2). Yield: 4.67 g (11.8 mmol, 47%). H NMR
(CDCl3, 300 MHz) δ = 8.70 (br, 1H), 7.71 (d, J = 15.9 Hz,
1H), 7.14−7.05 (m, 2H), 6.91 (d, J = 8.4 Hz, 1H), 6.32 (d, J =
15.9 Hz, 1H), 4.25−4.21 (m, 2H), 3.94−3.90 (m, 2H), 3.89 (s,
3H), 3.76−3.72 (m, 2H), 3.71−3.65 (m, 8H), 3.41−3.36 (m,
2H) ppm. 13C NMR (CDCl3, 75 MHz) δ = 172.0, 150.7, 149.5,
146.6, 127.3, 122.8, 115.0, 112.8, 110.2, 70.7, 70.6 (2 signals),
70.5, 69.9, 69.4, 68.3, 55.8, 50.5 ppm.
Syringic Acid Ethyl Ester. Syringic acid (3) 9.91 g (50.0
mmol) was dissolved in 250 mL of ethanol and treated with 30
mL (400 mmol) of thionyl chloride at 0 °C. After stirring
overnight at room temperature, the mixture was carefully added
to an ice-cold saturated aqueous solution of NaHCO3 until
neutralization. After evaporation of most of the alcohol, ethyl
acetate was added and the organic layer was separated. The
aqueous layer was discarded; the organic layer was washed with
brine and dried over MgSO4. Filtration and evaporation of the
solvent yielded 9.41 g (41.6 mmol, 83%) of the desired ester as
a white crystalline solid. 1H NMR (CDCl3, 300 MHz) δ = 7.33
B
dx.doi.org/10.1021/bc400074w | Bioconjugate Chem. XXXX, XXX, XXX−XXX

Bioconjugate Chemistry
Article
13C NMR (CDCl3, 75 MHz) δ = 170.2, 156.0, 152.9, 141.5,
124.6, 107.0, 79.1, 72.1, 70.5 (2 signals), 70.4, 70.3, 70.0 (2
signals), 56.0, 40.2, 28.2 ppm.
(s, 2H), 5.70 (br, 1H), 4.37 (q, J = 7.4 Hz, 2H), 3.94 (s, 6H),
1.40 (t, J = 7.4 Hz, 3H) ppm. 13C NMR (CDCl3, 75 MHz) δ =
166.3, 146.5, 139.0, 121.3, 106.5, 60.9, 56.3, 14.3 ppm.
4-(2-(2-(2-(2-Azidoethoxy)ethoxy)ethoxy)ethoxy)-3,5-di-
methoxybenzoic Acid Ethyl Ester 4. An amount of 9.4 g of
syringic acid ethyl ester (41.6 mmol) was dissolved in 150 mL
of DMF. Cs2CO3 (20.3 g, 62.4 mmol) and 2-(2-(2-(2-
azidoethoxy)ethoxy)ethoxy)ethyl methane sulfonate (13.4 g,
45.0 mmol) were added, and the mixture was stirred at 70 °C
for 4 h. The main amount of DMF was evaporated at reduced
pressure; the residue was suspended in ethyl acetate and
successively washed with satd aq ammonium chloride solution
and brine. After drying over MgSO4 and filtration, the solvents
(2S,4R)-N-Boc-4-((E)-3-(3,4-dimethoxyphenyl)acrylamido)-
proline Methyl Ester 9. An amount of 760 mg (3.65 mmol) of
3,4-dimethoxycinnamic acid (7) was dissolved in toluene (25
mL) and treated with 1.45 mL (2.38 g, 20.0 mmol) of thionyl
chloride. After refluxing for 4 h, the solvent and excess thionyl
chloride were removed by evaporation (60 °C, 130 mbar). The
residue was dissolved in chloroform and added dropwise to a
solution of 1.00 g (3.56 mmol) of 6 and 1.56 mL (1.16 g, 9.00
mmol) of diisopropylethylamine (DIPEA) in 20 mL of
chloroform at 0 °C. After stirring overnight at room
temperature, the organic solution was successively washed
with water, diluted hydrochloric acid, and brine and dried over
MgSO4. Filtration and evaporation of the solvent yielded 1.34 g
of a yellow foam, which was purified by flash column
chromatography (cyclohexane/ethyl acetate 1:1→1:2). Yield:
1
were evaporated. Yield: 17.0 g, 39.8 mmol, 96%. H NMR
(CDCl3, 300 MHz) δ = 7.29 (s, 2H), 4.37 (q, J = 7.2 Hz, 2H),
4.23−4.19 (m, 2H), 3.90 (s, 6H), 3.84−3.79 (m, 2H), 3.75−
3.70 (m, 2H), 3.69−3.65 (m, 8H), 3.39 (t, J = 4.8 Hz, 2H),
1.40 (t, J = 7.2 Hz, 3H) ppm. 13C NMR (CDCl3, 75 MHz) δ =
166.1, 152.9, 141.0, 125.5, 106.6, 72.1, 70.5 (4 signals), 70.3,
69.9, 61.0, 56.0, 50.5, 14.2 ppm.
1
800 mg of the product as a white foam (1.87 mmol, 52%). H
NMR (CDCl3, 300 MHz) δ = 7.57 (d, J = 15.9 Hz, 1H), 7.11−
7.00 (m, 2H), 6.84 (d, J = 8.4 Hz, 1H), 6.46 (d, br, J = 6.4 Hz,
0.6H), 6.35 (m, 0.4H), 6.33 (d, J = 15.9 Hz, 1H), 4.74−4.60
(m, 1H), 4.43 (t, J = 7.0 Hz, 0.4H), 4.30 (t, J = 7.8 Hz, 0.6H),
3.90 (s, 3H), 3.89 (s, 3H), 3.85−3.77 (m, 1H), 3.75 (s, 1.8H),
3.72 (s, 1.2H), 3.54−3.47 (m, 0.6H), 3.43−3.35 (m, 0.4H),
2.47−2.36 (m, 0.6H), 2.32−2.22 (m, 1.4H), 1.46 (s, 3.6H),
1.43 (s, 5.4H) ppm. 13C NMR (CDCl3, 75 MHz, major) δ =
173.0, 166.0, 153.8, 150.6, 149.1, 141.3, 127.6, 122.1, 118.0,
111.1, 109.6, 80.7, 57.7, 55.9, 55.8, 52.3, 51.6, 48.3, 37.1, 28.2
ppm. 13C NMR (CDCl3, 75 MHz, minor) δ = 172.6, 165.9,
154.2, 150.6, 149.1, 141.4, 127.6, 122.0, 117.9, 111.1, 109.5,
80.7, 57.5, 55.9, 55.8, 52.1, 51.6, 48.7, 36.0, 28.3 ppm. HRMS
(EI): m/z = 457.1937 [M + Na]+ (calcd 457.1945), 891.3983
[2M + Na]+ (calcd 891.3998), 1325.6004 [3M + Na]+ (calcd
1325.6051).
4-(2-(2-(2-(2-Aminoethoxy)ethoxy)ethoxy)ethoxy)-3,5-di-
methoxybenzoic Acid Ethyl Ester. The above azide (11.0 g,
25.7 mmol) was dissolved in ethanol (150 mL), and a small
portion of Pd/C (10%, Sigma-Aldrich) was added. The flask
was evacuated and refilled with hydrogen. This procedure was
repeated three times, and the mixture was stirred under a
hydrogen atmosphere overnight. Filtration over Celite (acid-
washed, Sigma-Aldrich) and evaporation of the solvent yielded
10.3 g (25.6 mmol, 99%) of the product as a clear oil. 1H NMR
(CDCl3, 300 MHz) δ = 7.21 (s, 2H), 4.29 (q, J = 7.2 Hz, 2H),
4.15−4.10 (m, 2H), 3.81 (s, 6H), 3.75−3.71 (m, 2H), 3.67−
3.53 (m, 11H), 3.45−3.41 (m, 1H), 3.35−3.29 (m, 1H), 2.80−
2.75 (m, 1H), 1.31 (t, J = 7.2 Hz, 3H) ppm. 13C NMR (CDCl3,
75 MHz) δ = 165.9, 152.8, 141.0, 125.3, 106.4, 72.0, 71.3, 70.4
(2 signals), 70.3, 70.2, 70.1, 60.8, 55.9, 51.1, 14.1 ppm.
4-(2-(2-(2-(2-N-Boc-aminoethoxy)ethoxy)ethoxy)ethoxy)-
3,5-dimethoxybenzoic Acid Ethyl Ester. The above amine
(5.05 g, 12.6 mmol) was dissolved in a 1:1 mixture of MeOH
and tBuOH (40 mL) and was treated with a solution of 3.27 g
(2S,4R)-N-Boc-4-((E)-3-(benzo[d][1,3]dioxol-5-yl)-
acrylamido)proline Methyl Ester 10. An amount of 700 mg
(3.64 mmol) of 3,4-methylenedioxycinnamic acid (8) was
dissolved in toluene (30 mL) and treated with 1.45 mL (2.38 g,
20.0 mmol) of thionyl chloride. After refluxing for 3.5 h, the
solvent and excess thionyl chloride were removed by
evaporation (60 °C, 130 mbar). The residue was dissolved in
chloroform and added dropwise to a solution of 1.00 g (3.56
mmol) of 6 and 1.56 mL (1.16 g, 9.00 mmol) of DIPEA in 20
mL of chloroform at 0 °C. After stirring overnight at room
temperature, the organic solution was successively washed with
water, diluted hydrochloric acid, and brine and dried over
MgSO4. Filtration and evaporation of the solvent yielded 1.32g
of an off-white foam, which was purified by flash column
chromatography (cyclohexane/ethyl acetate 1:1). Yield: 1.03 g
t
(15.0 mmol) of Boc2O in BuOH dropwise. The mixture was
stirred overnight at room temperature, then the solvent was
evaporated and the crude residue was purified by flash column
chromatography (cyclohexane/ethyl acetate 1:1), yield 4.95 g
1
(9.87 mmol, 78%). H NMR (CDCl3, 300 MHz) δ = 7.22 (s,
2H), 5.00 (br, 1H), 4.30 (q, J = 7.1 Hz, 2H), 4.16−4.11 (m,
2H), 3.82 (s, 6H), 3.76−3.72 (m, 2H), 3.68−3.63 (m, 2H),
3.61−3.52 (m, 6H), 3.46 (t, J = 4.8 Hz, 2H), 3.27−3.20 (m,
2H), 1.45 (s, 9H), 1.32 (t, J = 7.1 Hz, 3H) ppm. 13C NMR
(CDCl3, 75 MHz) δ = 166.2, 156.0, 152.9, 141.0, 125.5, 106.6,
79.1, 72.2, 70.6 (2 signals), 70.5, 70.4, 70.2, 70.1, 61.0, 56.1,
40.3, 28.4, 14.3 ppm.
1
of the product as a white foam (2.46 mmol, 70%). H NMR
4-(2-(2-(2-(2-N-Boc-aminoethoxy)ethoxy)ethoxy)ethoxy)-
3,5-dimethoxybenzoic Acid 5. The above ester (4.95 g, 9.87
mmol) was dissolved in a 3:1:1 mixture of THF/MeOH/water
(50 mL). Lithium hydroxide (1.44g 60.0 mmol) was added, and
the mixture was stirred overnight at room temperature. The
solvent were removed by evaporation and the residue taken up
in water and acidified with 2.5 M HCl. Extraction with
chloroform yielded the product as a clear oil (4.64 g, 9.80
mmol, 99%). 1H NMR (CDCl3, 300 MHz) δ = 11.22 (br, 1H),
7.27 (s, 2H), 5.10 (br, 1H), 4.17−4.13 (m, 2H), 3.82 (s, 6H),
3.76−3.72 (m, 2H), 3.69−3.63 (m, 2H), 3.62−3.53 (m, 6H),
3.48 (t, J = 5.1 Hz, 2H), 3.29−3.21 (m, 2H), 1.36 (s, 9H) ppm.
(CDCl3, 300 MHz) δ = 7.54 (d, J = 15.4 Hz, 1H), 7.00−6.95
(m, 2H), 6.79 (d, J = 8.9 Hz, 1H), 6.29−6.20 (m, 1.6H), 6.07−
6.01 (m, 0.4H), 5.99 (s, 2H), 4.65 (br, 1H), 4.43 (t, J = 6.9 Hz,
0.4H), 4.31 (t, J = 7.4 Hz, 0.6H), 3.90−3.77 (m, 1H), 3.75 (s,
3H), 3.50 (dd, J = 11.1 Hz, J = 2.5 Hz, 0.6H), 3.37 (dd, J = 11.3
Hz, J = 4.0 Hz, 0.4H), 2.45−2.35 (m, 0.6H), 2.33−2.22 (M,
1.4H), 1.46 (s, 3.6H), 1.43 (s, 5.4H) ppm. 13C NMR (CDCl3,
75 MHz, major) δ = 173.0, 166.0, 153.8, 149.2, 148.3, 141.3,
129.1, 124.0, 118.3, 108.5, 106.3, 101.4, 80.7, 57.8, 52.2, 51.6,
48.4, 37.1, 28.3 ppm. 13C NMR (CDCl3, 75 MHz, minor) δ =
172.7, 167.2, 154.4, 149.6, 148.3, 141.5, 129.0, 124.3, 118.0,
108.5, 106.5, 101.5, 80.7, 57.5, 52.2, 51.6, 48.7, 35.9, 28.4 ppm.
C
dx.doi.org/10.1021/bc400074w | Bioconjugate Chem. XXXX, XXX, XXX−XXX

Bioconjugate Chemistry
Article
HRMS (EI): m/z = 441.1637 [M + Na]+ (calcd 441.1638),
859.3372 [2M + Na]+ (calcd 859.3378), 1277.5097 [3M +
Na]+ (calcd 1277.5118).
Yield: 1.00 g (1.27 mmol, 69%). 1H NMR (CDCl3, 300 MHz)
δ = 7.53 (d, J = 15.6 Hz, 1H), 7.18−7.11 (m, 1H), 7.10−7.05
(m, 1H), 7.03−7.01 (m, 1H), 6.84 (d, J = 8.3 Hz, 1H), 6.76 (s,
2H), 6.23 (d, J = 15.6 Hz, 1H), 5.11−5.03 (m, 1H), 4.90−4.81
(m, 1H), 4.68−4.61 (m, 1H), 4.17−4.12 (m, 2H), 3.91 (s, 3H),
3.90 (s, 3H), 3.89−3.84 (m, 5H), 3.83 (s, 6H), 3.82−3.77 (m,
2H), 3.73−3.69 (m, 2H), 3.69−3.65 (m, 2H), 3.65−3.58 (m,
4H), 3.55−3.50 (m, 2H), 3.33−3.27 (m, 2H), 2.69−2.52 (m,
1H), 2.07 (br, 1H), 1.43 (s, 9H) ppm. 13C NMR (CDCl3, 75
MHz) δ = 174.7, 169.3, 165.6, 156.0, 153.2, 150.7, 149.1, 141.6,
139.2, 130.3, 127.5, 122.3, 118.0, 111.0, 109.5, 105.0, 79.1, 72.3,
70.6 (2 signals), 70.5, 70.4, 70.2, 70.1, 58.5, 56.8, 56.3 (2
signals), 55.9, 52.9, 49.1, 40.3, 34.6, 28.4 ppm. HRMS (EI): m/
z = 812.3571 [M + Na]+ (calcd 812.3576).
(2S,4R)-N-Boc-4-((E)-3-((((4-azidoethoxy)ethoxy)ethoxy)-
ethoxy-3-methoxybenzyl)-acrylamido)proline Methyl Ester
11. A solution of 1.60 g (4.00 mmol) 4, 610 mg (4.50
mmol) hydroxybenzotriazole hydrate (HOBT·H2O) and 1.45 g
(4.50 mmol) 2-(1H-benzotriazole-1-yl)-1,1,3,3-tetramethyluro-
nium tetrafluoroborate (TBTU) in 30 mL of DMF was treated
with 1.22 mL (900 mg, 6.7 mmol) DIPEA and 1.00 g (3.56
mmol) of 6 at room temperature. After stirring for 30 min,
another mL of DIPEA was added and the resulting mixture was
stirred for additional 23 h. Ethyl acetate was added, and the
organic phase was washed with diluted hydrochloric acid and
brine. After drying and filtration, the solvent was removed by
rotary evaporation and the residue was directly used in the next
step. HRMS (ESI): m/z = 644.2904 [M + Na]+ (calcd
644.2908).
(2S,4R)-4-((E)-3-(3,4-Dimethoxyphenyl)acrylamido)proline
Methyl Ester Trifluoro-acetate 12. A solution of 9 (800 mg,
1.84 mmol) in 10 mL of CH2Cl2 was treated with TFA (5 mL
in 5 mL of CH2Cl2) at 0 °C. After stirring overnight at room
temperature, the solvent and excess TFA was removed by
evaporation at reduced pressure. The remaining trifluoroacetate
12 was directly used in the next step.
(2S,4R)-4-((E)-3-(Benzo[d][1,3]dioxol-5-yl)acrylamido)-1-
(3,5-dimethoxy-4-(((2-N-Boc-aminoethoxy)ethoxy)ethoxy)-
ethoxybenzoyl)proline Methyl Ester 16. A solution of 1.21 g
(2.55 mmol) of 5 in 20 mL of DMF was treated with 380 mg
(2.80 mmol) of HOBt·H2O, 900 mg (2.80 mmol) TBTU and
730 μL (543 mg, 4.2 mmol) of DIPEA. To this was added a
solution of 1.18 g (2.46 mmol) of 13 and 1.0 mL (745 mg, 5.75
mmol) of DIPEA at 0 °C. After stirring overnight at room
temperature, ethyl acetate was added and the organic phase was
successively washed with water, diluted hydrochloric acid, and
brine. The organic layer was dried over MgSO4 and filtered.
The solvent was evaporated and the residue was purified by
flash column chromatography (5% MeOH in ethyl acetate),
(2S,4R)-4-((E)-3-(Benzo[d][1,3]dioxol-5-yl)acrylamido)-
proline Methyl Ester Trifluoro-acetate 13. To a solution of
1.03 g (2.46 mmol) of 10 in CH2Cl2 was added a solution of
3.0 mL of TFA in 7.0 mL of CH2Cl2 at 0 °C. After stirring
overnight at room temperature, the solvent and excess TFA was
removed by rotary evaporation and the residue was taken up in
10 mL of methanol. The alcohol was evaporated, and the
procedure was repeated twice. Yield: 1.04 g of an off-white
1
yielding 1.375 g of a white foam (1.78 mmol, 72%). H NMR
(CDCl3, 300 MHz) δ = 7.67 (br, 1H), 7.36 (d, J = 15.6 Hz,
1H), 6.74−6.66 (m, 2H), 6.63 (s, 2H), 6.46 (s, 1H), 6.10 (d, J
= 15.6 Hz, 1H), 5.95 (s, 2H), 5.28−5.18 (m, 1H), 5.06 (br,
1H), 4.80 (br, 1H), 4.03 (dd, J = 11.2 Hz, J = 4.5 Hz, 1H), 3.85
(s, 3H), 3.83−3.77 (m, 3H), 3.65 (s, 6H), 3.63−3.57 (m, 10H),
3.53 (t, J = 7.8 Hz, 2H), 3.34−3.26 (m, 2H), 2.54−2.28 (m,
2H), 1.43 (s, 9H) ppm. 13C NMR (CDCl3, 75 MHz) δ = 172.3,
170.1, 166.0, 156.0, 153.1, 149.0, 148.1, 140.6, 129.0, 124.0,
118.6, 108.3, 105.8, 104.9, 101.3, 79.2, 72.1, 70.6, 70.5, 70.2,
55.8, 52.6, 49.2, 40.3, 28.3 ppm (due to broadening the
remaining signals could not be detected). HRMS (EI): m/z =
769.3262 [M + Na]+ (calcd 796.3263).
(2S,4R)-4-((E)-3-(3-Methoxy-4-(((2-azidoethoxy)ethoxy)-
e t h o x y ) e t h o x y p h e n y l ) a c r y l - a m i d o ) - 1 - ( 3 , 4 , 5 -
trimethoxybenzoyl)proline Methyl Ester 17. The above amino
trifluoroacetate 14 was dissolved in CH2Cl2 (30 mL) and
treated with 1.0 mL (0.73 g, 7.20 mmol) of triethylamine
(TEA). Then a solution of 920 mg (4.00 mmol) of 3,4,5-
trimethoxybenzoylchloride in 20 mL of CH2Cl2 was added at 0
°C. After stirring overnight at room temperature, the organic
phase was extracted twice with diluted hydrochloric acid, water,
and brine. Flash column chromatography (10% MeOH/ethyl
acetate) yielded 1.75 g (2.44 mmol, 69%) of the product as a
white foam. 1H NMR (CDCl3, 300 MHz) δ = 7.56 (d, 7.5 Hz,
1H), 7.43 (d, J = 15.9 Hz, 1H), 6.74 (s, 3H), 6.67 (s, 2H), 6.19
(d, J = 15.9 Hz, 1H), 5.20−5.13 (m, 1H), 4.82−4.75 (m, 1H),
4.18−4.13 (m, 2H), 4.07 (dd, J = 11.4 Hz, J = 4.5 Hz, 1H),
3.89−3.84 (m, 2H), 3.82 (s, 3H), 3.78−3.70 (m, 6H), 3.70−
3.62 (m, 10H), 3.66 (s, 6H), 3.37 (t, J = 5.2 Hz, 2H), 2.56−
2.28 (m, 2H), 2.00−1.90 (m, 1H) ppm. 13C NMR (CDCl3, 75
MHz) δ = 172.3, 169.9, 166.2, 152.9, 149.8, 149.3, 141.0, 140.3,
129.6, 127.8, 121.7, 118.3, 112.8, 110.1, 105.0, 70.8, 70.6, 70.5,
70.0, 69.4, 68.3, 67.9, 60.6, 58.0, 57.4, 55.9, 55.7, 52.6, 50.6,
49.4, 35.1 ppm. HRMS (EI): m/z = 796.3262 [M + Na]+
(calcd 796.3269).
1
foam (2.40 mmol, 98%). H NMR (DMSO-d6, 300 MHz) δ =
10.07 (br, 1H), 9.21 (br, 1H), 8.51 (d, J = 6.3 Hz, 1H), 7.37 (d,
J = 15.6 Hz, 1H), 7.15 (d, J = 1.5 Hz, 1H), 7.06 (dd, J = 8.1 Hz,
J = 1.5 Hz, 1H), 6.93 (d, J = 8.1 Hz, 1H), 6.41 (d, J = 15.6 Hz,
1H), 6.05 (s, 2H), 4.67−4.59 (m, 1H), 4.47−4.37 (m, 1H),
3.77 (s, 3H), 3.57 (dd, J = 12.0 Hz, J = 6.7 Hz, 1H), 3.16 (dd, J
= 12.0 Hz, J = 4.6 Hz, 1H), 2.42−2.21 (m, 2H) ppm. 13C NMR
(DMSO-d6, 75 MHz) δ = 168.9, 165.5, 158.6 (q, J = 36 Hz,
TFA), 148.8, 148.1, 139.4, 129.1, 123.6, 119.4, 115.7 (q, J = 290
Hz, TFA), 108.7, 106.2, 101.6, 57.9, 53.2, 50.3, 48.1, 33.4 ppm.
(2S,4R)-4-((E)-3-((((4−2-Azidoethoxy)ethoxy)ethoxy)-
ethoxy-3-methoxybenzyl)-acrylamido)proline Methyl Ester
Trifluoroacetate 14. The above Boc-protected proline 11
was dissolved in 20 mL of CH2Cl2 and treated with 5 mL of
TFA at 0 °C. After stirring overnight at room temperature, the
solvent and excess TFA was removed by rotary evaporation.
The foamy residue was directly used in the next step.
(2S,4R)-4-((E)-3-(3,4-Dimethoxyphenyl)acrylamido)-1-(3,5-
dimethoxy-4-(((2-N-Boc-aminoethoxy)ethoxy)ethoxy)-
ethoxybenzoyl)proline Methyl Ester 15. The above trifluoro-
acetate 12 was taken up in DMF (10 mL) and combined with a
solution of 5 (600 mg, 1.30 mmol), TBTU (515 mg, 1.60
mmol), HOBt·H2O (220 mg, 1.60 mmol), and 260 mg (350
μL, 2.00 mmol) of DIPEA in DMF (10 mL). After stirring the
mixture overnight at room temperature, most of the solvent was
removed on a rotary evaporator and the residue was separated
between water and ethyl acetate. The organic phase was
successively washed with diluted hydrochloric acid, water, and
brine and dried over MgSO4. After filtration and evaporation,
the residue was purified by flash column chromatography.
D
dx.doi.org/10.1021/bc400074w | Bioconjugate Chem. XXXX, XXX, XXX−XXX

Bioconjugate Chemistry
Article
(2S,4R)-4-((E)-3-(3-Methoxy-4-(((2-aminoethoxy)ethoxy)-
e t h o x y ) e t h o x y p h e n y l ) a c r y l - a m i d o ) - 1 - ( 3 , 4 , 5 -
trimethoxybenzoyl)proline Methyl Ester 18. To a solution of
17 (1.30 g, 1.80 mmol) in 20 mL of THF was added 1.05 g
(4.00 mmol) of triphenylphosphine, and the mixture was
stirred for 1 h at room temperature. Then 100 μL of water were
added, and the resulting mixture was stirred for additional 48 h.
The solvent was evaporated, and the residue was purified by
flash column chromatography (ethyl acetate → ethyl acetate/
MeOH 4:1 + 2% TEA), yielding 1.19 g of a clear oil (1.70
mmol, 96%). 1H NMR (CDCl3, 300 MHz) δ = 7.82 (d. J = 7.6
Hz, 1H), 7.42 (d, J = 15.7 Hz, 1H), 6.74 (s, 3H), 6.66 (s, 2H),
6.21 (d, J = 15.7 Hz, 1H), 5.17 (t, J = 8.5 Hz, 1H), 4.78 (s, 1H),
4.15 (t, J = 4.6 Hz, 2H), 4.07 (dd, J = 11.2 Hz, J = 4.4 Hz, 1H),
3.86 (t, J = 4.7 Hz, 2H), 3.82 (s, 3H), 3.75−3.59 (m, 21H),
3.51 (t, J = 5.1 Hz, 2H), 2.86 (t, J = 5.1 Hz, 2H), 2.56−2.46 (m,
1H), 2.40−2.30 (m, 1H), 2.27 (br, 2H) ppm. 13C NMR
(CDCl3, 75 MHz) δ = 172.2, 169.8, 166.2, 152.8, 149.7, 149.3,
140.7, 140.2, 129.5, 127.9, 121.5, 118.5, 112.8, 110.1, 105.0,
73.0, 70.7, 70.5, 70.4, 70.2, 69.4, 68.3, 60.6, 58.0, 57.3, 55.8,
55.6, 52.6, 49.4, 41.6, 35.0 ppm. HRMS (ESI): m/z = 690.3235
[M + H]+ (calcd 690.3233), 712.3047 [M + Na]+ (calcd
712.3052).
General Procedure for the Synthesis of Hydroxamic Acids
from Methyl Esters. Powdered KOH (840 mg, 15.0 mmol) was
dissolved in 15 mL of MeOH under argon. In a separate flask,
700 mg (10.0 mmol) of NH2OH·HCl was dissolved in 10 mL
of MeOH under argon. Both solutions were briefly refluxed and
then cooled to below 40 °C. The KOH solution was transferred
into the NH2OH solution, and the mixture was stirred for 1 h at
40 °C. KCl was allowed to precipitate, and the supernatant
solution was transferred into a solution of the methyl ester (1−
2 mmol) in MeOH. The resulting mixture was stirred at room
temperature for 24 h, then the solvent was evaporated and the
residue was taken up in diluted hydrochloric acid and extracted
with ethyl acetate. The combined organic portions are washed
with brine, dried (MgSO4), and filtered, and the solvent was
evaporated.
(2S,4R)-4-((E)-3-(3-Methoxy-4-(((2-aminoethoxy)ethoxy)-
e t h o x y ) e t h o x y p h e n y l ) a c r y l - a m i d o ) - 1 - ( 3 , 4 , 5 -
trimethoxybenzoyl)proline Hydroxamic Acid 21. From 1.19 g
(1.70 mmol) of the methyl ester 18 an amount of 686 mg (1.00
mmol, 59%) of the product 21 could be isolated after
purification by HPLC (conditions see above). HRMS (ESI):
m/z = 691.3179 [M + H]+ (calcd 691.3185).
(2S,4R)-4-((E)-3-(3,4-Dimethoxyphenyl)acrylamido)-1-(3,5-
dimethoxy-4-(((2-amino-ethoxy)ethoxy)ethoxy)-
ethoxybenzoyl)proline Hydroxamic Acid 22. From 900 mg
(1.14 mmol) of the methyl ester 15 an amount of 599 mg (753
μmol, 65%) of the Boc-protected intermediate 19 was isolated.
HRMS (ESI): m/z = 813.3507 [M + H]+ (calcd 813.3534).
Deprotection with TFA in CH2Cl2 for 24 h at room
temperature yielded 600 mg (745 μmol, 99%) of the amino
trifluoroacetate hydroxamic acid derivative 22. For conjugation,
the compound can be purified by HPLC. HRMS (ESI): m/z =
691.3192 [M + H]+ (calcd 691.3185).
temperature yielded the amino trifluoroacetate hydroxamic
acid derivative 23. After purification by HPLC, an amount of
337 mg can be isolated (58%). HRMS (ESI): m/z = 675.2868
[M + H]+ (calcd 675.2872).
Fluorescent Labeling of Amino-PEG Derivatives.
Amino derivatives 21 and 23 were chosen for labeling
experiments. An amount of 0.7 mg (1.0 μmol) of 21 or 23,
respectively, were dissolved in 100 μL of DMSO and
transferred into 700 μL of 0.1 M NaHCO3 buffer of pH 8.8.
To these solutions were added 1.1 mg (1.0 μmol) of Cy 5.5
NHS ester dissolved in 200 μL of DMSO. After shaking for 4 h
at room temperature, the mixtures were transferred into the
HPLC system and purified using the same setup as for the
hydroxamic acid derivatives (see above). The desired fractions
were collected, and after evaporation of the solvent the residues
were reconstituted in PBS. The identities of the conjugates
were proven by mass spectrometry. HRMS of Cy 5.5-21 (ESI):
m/z = 1589.47805 [M + H]+ (calcd 1589.47547). HRMS of Cy
5.5-23 (ESI): m/z = 1573.44804 [M + H]+ (calcd 1573.44417).
The concentrations of the tracers were determined by
photometric measurements using a Hitachi U-3010 spectro-
photometer (Hitachi High-Technologies Europe GmbH,
Mannheim, Germany). At least five different concentrations
of the reconstituted solutions were measured at a wavelength of
676 nm. After recording the absorption values, the concen-
trations were determined employing Lambert−Beer’s law
(absorption coefficient ελ = 250.000 L·mol−1·cm−1).
Cell Lines and Reagents. Human breast cancer cells BT-
20 (ATCC: HTB-19; Manassas, VA) were cultured in Gibco’s
MEM (Invitrogen, San Diego, CA) supplemented with 10%
fetal calf serum (FCS), 1% penicillin and streptomycin, 1%
glutamine, 1% nonesential amino acids, 1% Na-pyruvate, and
18.8 mM NaHCO3. Human BT-549 cells (ATCC: HTB-122;
Manassas, VA) were cultured in ATCC-formulated RPMI-1640
medium supplemented with 0.023 μU/mL insulin (Sigma-
Aldrich Biochemie GmbH, Hamburg, Germany) and 10% FCS.
Cells were grown routinely in a monolayer culture at 37 °C in a
5% CO2 humidified air atmosphere. For flow and immunocy-
tometry, a monoclonal antibody specific for human APN
(antiCD13-FITC, AM 00642FC-N/ABIN263533 Acris Anti-
bodies, Herford, Germany) was used (FITC = fluorescein
isothiocyanate). Primer for RT-PCR were designed for human
APN; fwd, CAGGACGCCACCTCTACCAT; rev, GAAGGA-
GAACGAGCCACCAC (product 126 bp) and housekeeping
gene human β-actin (BC002409); fwd, CTGGGACGACATG-
GAGAAAA; rev, AAGGAAGGCTGGA-AGAGTGC (Eurofins
MWG Operon, Ebersberg, Germany). APN substrate L-alanine-
4-methyl-7-coumarinylamido trifluoroacetate (MCA) was from
Sigma-Aldrich Biochemie GmbH, Hamburg, Germany.
Cell Toxicity/Growth Inhibition. Cells (1 × 105) were
seeded in 4-well plates and incubated at 37° (5% CO2)
overnight (conditions see above). Different concentrations (10
μM, 50 μM, 150 μM, and 300 μM) of 21, 22, and 23,
respectively, or 300 μM of free cyanine dye Cy 5.5 were added
and incubation was maintained for 4 days. After three days,
culture media were exchanged by fresh media including
inhibitors or dye. The cell numbers were determined by
trypan-blue staining and Neubauer chamber counting every 24
h and compared to those without inhibitor.
(2S,4R)-4-((E)-3-(Benzo[d][1,3]dioxol-5-yl)acrylamido)-1-
(3,5-dimethoxy-4-(((2-amino-ethoxy)ethoxy)ethoxy)-
ethoxybenzoyl)proline Hydroxamic Acid 23. From 570 mg
(737 μmol) of the methyl ester 16 an amount of 560 mg (702
μmol, 95%) of the Boc-protected intermediate 20 was isolated.
HRMS (ESI): m/z = 797.3186 [M + H]+ (calcd 797.3216).
Deprotection with TFA in CH2Cl2 for 24 h at room
Flow Cytometry. Cultured cells were washed with PBS
(Ca2+/Mg2+), harvested with trypsin, resuspended, centrifuged
(3 min at 500g) and washed again with PBS (Ca2+/Mg2+).
Aliquots of 2.5 × 105 cells were blocked with PBS/BSA (0,1%)
E
dx.doi.org/10.1021/bc400074w | Bioconjugate Chem. XXXX, XXX, XXX−XXX

Bioconjugate Chemistry
Article
a
Scheme 1. PEG Modification of Aromatic Building Blocks
a
Compounds 2 and 5 were synthesized beginning with commercially available starting material ferulic (1) and syringic acid (3), respectively. The
key step is the installation of the PEG spacer by utilizing Ms(OCH2CH2)4N3, which has been introduced earlier.17 Yields are given as isolated yields.
for 15 min at 4 °C, washed twice with PBS (Ca2+/Mg2+), and
resuspended in 150 μL of binding buffer (150 mM NaCl, 10
mM MgCl2, 10 mM CaCl2, 0.5 mM MnCl2, pH 7.2, diluted
1:20 in PBS/BSA 0,1%). Antibodies (AM 00642FC-N, Acris
Antibodies, Herford, Germany; 1 μg/1 Mio cells) and
propidium iodide (AnaSpec, Liege, Belgium; 1 μL/200 μL
sample) were added and incubated for 45 min at 4 °C in the
dark. Cells were washed, resuspended in PBS/BSA (0.1%), and
medium overnight. For binding studies, cells were washed with
PBS and fixated (PBS with 4% formaldehyde) for 10 min at
room temperature, washed, blocked (PBS/BSA 0.1%) for 15
min, washed twice (PBS/Ca2+/Mg2+), and preincubated in
binding buffer (150 mM NaCl, 10 mM MgCl2, 10 mM CaCl2,
0.5 mM MnCl2, pH 7.2, 1 min, room temperature). Binding
buffer was removed, and 100 μL/well of fluorescent tracer or
Cy 5.5 alone (2 μM, PBS) were added. After an incubation
period of 4 h at room temperature, cells were washed, stained
with DAPI (counterstain), washed again, and Fluoromount
(Sigma Aldrich, St. Louis, MI) and cover slides were added. For
blocking studies, cells were washed with PBS twice and treated
with 333 μM concentration of bestatin in binding buffer for 10
min. The blocking solution was removed, and 100 μL/well of
fluorescent tracer (2 μM, PBS) were added. After an incubation
period of 1 h at room temperature, cells were washed again
with PBS/Ca2+/Mg2+, and Fluoromount (Sigma Aldrich, St.
Louis, MI) and cover slides were added. Cells could be directly
visualized by fluorescence microscopy.
APN/CD13 Activity Assay. Activity and inhibition of
surface aminopeptidase was measured on adherent BT-549 cells
utilizing MCA as fluorogenic APN substrate.19 A number of 2 ×
104 cells/well were plated in a 96-well plate (Lumox Multiwell,
Greiner Bio-One GmbH, Frickenhausen, Germany). After 24 h
of recovering in culture medium, cells were washed with PBS
and incubated with 100 μM MCA in PBS with 0.5% BSA and
20 mM HEPES (pH 7.2). The release of fluorescent product 7-
amino-4-methylcoumarin was monitored on a Kodak Gel Logic
200 imaging system (Carestream Health Inc., Rochester, NY),
with λexc = 360 nm and λem = 460 nm after 60 min. To assay for
inhibition of enzymatic activity due to binding of new designed
CD13/APN inhibitors, cells were pretreated in assay buffer
containing different amounts (5 × 10−7 to 4 × 10−4 M) of the
inhibitor at 37 °C for 30 min.
analyzed on a CyFlow Space (Partec, Munster, Germany).
̈
Distribution of cells according to their fluorescence (FL1)
intensity were documented; FL1 < 1 no specific binding.
RNA Isolation and RT-PCR. Total RNA was isolated from
freshly harvested cells by using RNA Isolation Kit (RNeasy
Mini Kit, Qiagen GmbH, Hilden, Germany). RNA concen-
tration was estimated by Nanodrop spectrophotometer
measurements (PEQLAB Biotechnologie GmbH, Erlangen,
Germany). APN/CD13 expression was analyzed by using
OneStep RT-PCR Kit (Qiagen GmbH, Hilden, Germany)
following the instructions of the manufacturer. PCR-Pro-
gramm: 50 °C for 30 min, 95 °C for 15 min (94 °C for 30
s, 55−57 °C for 30 s, 72 °C for 1 min), 30 cycles, 72 °C for 1
min. The products were analyzed by 1% agarose gel
electrophoresis.
Immunocytometry. First, 50000 cells/100 μL were seeded
on slides, incubated at 37° (5% CO2) overnight, washed with
PBS, and incubated in fixation solution (4% Formalin, room
temperature, 10 min). After washing with PBS, the cells were
then incubated in blocking solution (PBS/BSA, 0.1%, 15 min,
room temperature), washed twice in PBS (Ca2+/Mg2+), and
preincubated in binding buffer (50 mM NaCl, 10 mM MgCl2,
10 mM MnCl2, pH 7.2). The cells were incubated with the
antibody (1:100) at room temperature for 45 min and washed
with PBS. Nuclear counterstaining was performed with 4′,6-
diamidino-2-phenylindole (DAPI). Staining procedures in the
absence of the antibody and in the presence of control IgG1,
respectively, served as controls. Immunofluorescence was
evaluated using a fluorescence microscopy (20× objective
magnification, Nikon TE 2000-S). The microscope was
equipped with a mercury vapor lamp, 377/447, 480/535, and
620/775 nm (excitation/emission) filters (DAPI, FITC and Cy
5.5, respectively), a Nikon DXM1200F camera, and Nikon’s
NIS-Elements software (Nikon, Tokyo, Japan).
Data and Statistics. Cell numbers from cell growth
inhibition experiments were determined from 3−4 different
wells, and the means, standard deviations, and standard errors
were calculated. Data from enzyme inhibition assays were
processed by GraphPad Prism 4.0 software, and IC50 values
were determined by nonlinear regression analysis using a one-
site competition model. All results are presented as mean
SEM.
In Vitro CD13/APN Tracer Binding Studies on Cells.
First, 50000 cells/100 μL were incubated on slides in culture
F
dx.doi.org/10.1021/bc400074w | Bioconjugate Chem. XXXX, XXX, XXX−XXX

Bioconjugate Chemistry
Article
a
Scheme 2. Synthetic Route to Carboxylic Acid Esters 15, 16, and 18
a
Starting from trans-4-amino-N-Boc-L-proline methyl ester hydrochloride (6), the caffeic acid building blocks and the benzoyl building blocks are
successively installed. Yields are given as isolated yields (n.d. = not determined).
a
Scheme 3. Final Conversion of the Carboxylic Acid Esters to the Hydroxamic Acids 21, 22, and 23
a
For the transformation of the methyl esters to the hydroxamic acids, a protocol adapted from Fieser and Fieser48 was used, employing a methanolic
solution of NH2OK. Final deprotection of N-Boc-protected hydroxamates 19 and 20 then yields amino−PEG hydroxamic acids 22 and 23. Yields
are given as isolated yields, except yield of compound 23 (after HPLC purification).
hydroxamic acids, a protocol adapted from Fieser and Fieser48
was used, employing a methanolic solution of NH2OK. Final
deprotection of N-Boc-protected hydroxamates 19 and 20 then
RESULTS
■
Chemistry. This work aimed at the synthesis of different 4-
cinnamamido-1-(benzyloxy)proline derivatives as fluorescent
yielded amino-PEG hydroxamic acids 22 and 23. Together with
amino-PEG hydroxamate 21, a total of three different precursor
compounds were synthesized which were directly used for dye
conjugation (Scheme 3). We chose compounds 21 and 23 for
labeling experiments. After purification by HPLC, we
reconstituted the conjugates Cy 5.5-21 and Cy 5.5-23 (Figure
2) in PBS buffer for further in vitro experiments.
Target Identification. We determined the APN-expression
of BT-549 and BT-20 cells by immunocytometry, FACS
analysis, and RT-PCR (Figure 3). The strong binding of the
specific monoclonal antibody AM 00642FC-N to BT-549 cells
identified a high amount of target on the cell surface, whereas
very low binding of this antibody to BT-20 cells was observed.
This is in accordance with FACS analysis, which shows that
more than 90% of BT-549 cells show a high binding of the
antibody compared to only 0.02% of BT-20 cells. Also, RT-
PCR examination of the cells reveals a high amount of hAPN in
BT-549 cells, whereas BT-20 cells do not express this gene.
biomarkers for the detection of aminopeptidase N (APN). For
labeling purposes, we assembled a short polyethylene glycol
(PEG) spacer with an amino group as the coupling site on
either the benzoyl or the cinnamoyl residue of the lead
structure. We therefore synthesized PEG-modified cinnamoyl
derivative 2 and PEG-modified benzoyl derivative 5 (Scheme
1), which were then coupled to the proline ring on the 1- or 4-
position, respectively. Both compounds were modified using 2-
(2-(2-(2-azidoethoxy)ethoxy)ethoxy)ethyl methane sulfo-
nate.20 In further steps trans-4-amino-N-Boc-L-proline methyl
ester hydrochloride 6 was coupled to cinnamic acid derivatives
3,4-dimethoxycinnamic acid 7, 3,4-methylenedioxycinnamic
acid 8, or azido-PEG-derivative 2, yielding aminoproline amides
9−11. Deprotection with TFA in CH2Cl2 then yielded amines
12−14, which were further coupled with 3,4,5-trimethoxyben-
zoylchloride or syringic acid derivative 5 to give aminoproline
bisamides 15−17. The azide function of 17 was further
modified by Staudinger reduction to yield amine 18 (Scheme
2). For the transformation of the methyl esters to the
G
dx.doi.org/10.1021/bc400074w | Bioconjugate Chem. XXXX, XXX, XXX−XXX

Bioconjugate Chemistry
Article
Figure 2. Structure of the differently substituted fluorescent tracers Cy 5.5-21 and Cy 5.5-23. The ligand is displayed in red color, the PEG spacer in
black, and the fluorescent dye Cy 5.5 in blue.
Figure 3. Target expression analysis of human breast cancer cell lines BT-549 and BT-20. (A,B) Immunocytometry on BT-549 (A) and BT-20 (B)
cells using a FITC-labeled monoclonal antibody against human APN. (C,D) FACS analysis of BT-549 (C) and BT-20 (D) cells. The same antibody
as in immunocytometry experiments was used. (E) Agarose gel visualization of RT-PCR examination of RNA from BT-549 and BT-20 cells. All
experiments confirm a high target expression in BT-549 cells and negative results for BT-20 cells.
Inhibition Assays. Enzyme inhibition assays show a
pronounced difference in the effects of 21, 22, and 23. The
regression curves are displayed in Figure 4A, and the results are
displayed in Table 1. For comparison, known values from the
literature are given for lead compound I2 and bestatin.
Compounds 22 and 23 show micromolar inhibition values
comparable to the lead I2 and bestatin, while 21 only shows a
negligible value.
compared to a control and the applied fluorescent dye Cy 5.5
alone. Especially after 96 h, there was an obvious difference in
the effects of 22 and 23 from that of 21. Compounds 22 and 23
show a well-defined stepwise concentration-dependent decrease
in cell number. Compound 21 has a more toxic effect on cells;
after incubation with a concentration of 150 μM no vital BT-
549 cells remain. Incubating BT-20 cells results in a different
pattern. In this case, none of the inhibitors causes a marked
toxic (i.e., growth-inhibiting) effect. The cyanine dye Cy 5.5
does not show a marked toxic effect on BT-549 cells, the cell
number of BT-20 cells is decreased by 30%.
Cell Toxicity. The toxic effects of increasing concentrations
of compounds 21−23 on cell growth and survival were
examined on BT-549 and BT-20 cells (Figure 4B,C) and
H
dx.doi.org/10.1021/bc400074w | Bioconjugate Chem. XXXX, XXX, XXX−XXX

Bioconjugate Chemistry
Article
Table 1. Determined Affinity Values of Our Synthesized
Compounds to APN in Comparison to Those Reported in
the Literature
compd
IC50 (APN) (μM)
lit.
I2
63.9
>500
149.2
14.3
2.1 nM31
21
22
23
bestatin
12.0
13.1 μM47
In cell binding assays, Cy 5.5-23 shows binding to APN-positive
BT-549 cells (Figure 5A,D) but not to APN-negative BT-20
cells (Figure 5C,F). Also, we found that Cy 5.5-21 does not
bind to BT-549 cells, as shown in Figure 5B,E. The binding
specificity of Cy 5.5-23 can be concluded from the absence of
binding of Cy 5.5 alone to BT-549 (Figure 5G, Cy 5.5; 5K, Cy
5.5/DAPI merge) and BT-20 cells (Figure 5H, Cy 5.5;5L, Cy
5.5/DAPI merge) and from predosing experiments with
bestatin. While Cy 5.5-23 strongly binds to BT-549 cells in
the absence of bestatin (Figure 5E,F), its binding is inhibited
with 100-fold excess of bestatin (Figure 5G,H).
DISCUSSION
■
Angiogenic vessels have become a popular target for molecular
imaging approaches as well as targeted therapies in recent
years.21 Especially the vascular endothelial growth factor
(VEGF) and its receptors (VEGFRs) have been frequently
used as targets for various imaging approaches. Backer et al.
designed a recombinant single-chain VEGF protein which
could be labeled with either 99mTc, 64Cu, or fluorescent dye Cy
5.5 and performed SPECT, PET, and optical imaging in mouse
models of breast cancer.22 Another prominent target for
molecular imaging of angiogenesis are integrins (e.g., ανβ321,23).
Phage display techniques revealed a characteristic feature of
integrins, including ανβ3, which is its high affinity to the amino
acid motif arginine-glycine-aspartate, RGD.24 Small peptides
containing the RGD sequence have therefore been used as
vehicles to target integrins in molecular imaging ap-
proaches.25−27 [18F]Galacto-RGD, a pharmacokinetically opti-
mized cyclic peptide conjugate for PET imaging, has even been
applied clinically.28
Aminopeptidase N (APN/CD13) is becoming more and
more prominent as another key player in angiogenic processes.
Especially in many human cancers, APN has been shown to be
overexpressed on the cell surface of tumor cells, but also in
murine infarction models, a 20-fold up-regulation of APN in
the angiogenic infarct border was found compared to
nonischemic control tissue, emphasizing its relevance in
nontumor-associated pathological angiogenesis.29 Natural and
synthetic inhibitors of APN have recently been reviewed.30,31
Bradykinin and substance P are natural peptides capable of
inhibiting APN in micromolar concentrations. The most widely
used compound is bestatin (Ubenimex), a dipeptidic
compound first isolated from Streptomyces olivoreticuli. Bestatin
exhibits inhibitory effects on several aminopeptidases, including
APN, leucin aminopeptidase (LAP), and leukotriene A4
hydrolase, and is therefore a rather unspecific inhibitor. A
multicenter, double blind, randomized phase III clinical study
using bestatin in patients with stage I squamous-cell lung
carcinoma has been completed in 2003. The administration of
bestatin as a postoperative, adjuvant treatment was associated
with a prolonged survival of patients with completely resected
Figure 4. (A) Results of enzyme inhibition assays. Nonlinear
regression analysis of the effect of compounds 21−23 and bestatin
on MCA turnover of BT-549 cells yield IC50 values in the micromolar
range for 22, 23, and bestatin; a value for compound 21 could not be
determined. (B,C) Cell growth inhibition analysis of selected
compounds on human breast cancer cell lines BT-549 and BT-20.
Cell number after coincubation of cells with APN inhibitors 21−23 in
increasing concentrations (10, 50, 150, and 300 μM, left to right) is
shown (mean SEM). In addition, cell number without any inhibitor
and cell number after incubation with 300 μM Cy 5.5 is displayed.
Compound 21 is found to behave differently compared to 22 and 23.
While incubation of BT-549 cells with 22 and 23 shows a well-defined
stepwise concentration-dependent decrease in cell number, compound
21 has a more toxic effect on cells; after incubation with a
concentration of 150 μM, no vital cells remain. Incubating BT-20
cells results in a different pattern. In this case, no inhibitor exhibits any
marked toxic effect. Also, the dye Cy 5.5 only shows marginal effects
on cell growth on either cell line.
Cell Binding Assays. Fluorescent labeling of precursor
compounds 21 and 23 was performed with Cy 5.5 NHS-ester.
I
dx.doi.org/10.1021/bc400074w | Bioconjugate Chem. XXXX, XXX, XXX−XXX

Bioconjugate Chemistry
Article
Figure 5. Tracer binding studies of Cy 5.5-21 and Cy 5.5-23 on human breast cancer cell lines BT-549 and BT-20. Incubation with tracer Cy 5.5-23
shows binding to BT-549 cells ((A) Cy 5.5, (D) Cy 5.5/DAPI merge), while Cy 5.5-21 does not show any binding ((B) Cy 5.5, (E) Cy 5.5/DAPI
merge). Also, binding of Cy 5.5-23 to BT-20 cells could not be observed ((C) Cy 5.5, (F) Cy 5.5/DAPI merge). The specificity of binding of Cy 5.5-
23 can be concluded from the absence of binding of Cy 5.5 alone on BT-549 ((G) Cy 5.5, (K) Cy 5.5/DAPI merge) and BT-20 cells ((H) Cy 5.5,
(L) Cy 5.5/DAPI merge) and from predosing experiments with bestatin on nonfixated cells. While Cy 5.5-23 strongly binds to BT-549 cells in the
absence of bestatin ((I) phase contrast, (M) Cy 5.5), its binding is inhibited with 100-fold excess of bestatin (J) phase contrast, (N) Cy 5.5).
stage I without adverse toxic effects.32 APN also exhibits a high
affinity to peptides containing the amino acid motif
asparagine−glycine−arginine (NGR). In a therapeutic ap-
proach, a conjugate of a truncated mutant form of human
coagulation-inducing protein tissue factor and an NGR-
containing peptide was demonstrated to selectively inhibit
tumor perfusion during first-in-man studies.33 APN inhibitors
for therapeutic applications are developed since the early 1990s.
A number of thiol-containing derivatives have been shown to
have a high affinity to APN.34−36 Xu and co-workers have
described the synthesis of several nonpeptidic compounds,
summarized in a recent concise review.37 Many of the
developed compounds contain a hydroxamic acid moiety, a
common structural element for chelating bivalent cations like
Zn2+. The lead structure I2 has been introduced by Xu and Li
in 2005 and was described to have affinities in the low
nanomolar range.31 Our investigations utilizing the turnover of
MCA as substrate for monitoring APN activity yielded
micromolar inhibitory values for I2, 22, and 23.
to APN. Additionally, this difference in reactivity could also be
observed in cell growth inhibition examinations, where 21
behaved significantly different compared to 22 or 23, which
showed a well-defined inhibitory effect on APN-positive BT-
549 cell growth. This stepwise, concentration-dependent cell
growth toxicity displayed by 22 and 23 can probably be
attributed to specific inhibition of APN. The toxicity of the
fluorescent dye Cy 5.5 alone on cells was negligible on BT-549
cells and marginal on BT-20 cells. In the literature, there is not
much data on Cy 5.5 toxicity, a comparison to ICG with an
LD50 of 50 mg/kg in mice38 shows that presumably there exists
a large dosage window. To more closely evaluate the highly
toxic but presumably not APN-dependent effect of 21 on cells,
we tested the potencies of our precursor compounds 21−23
toward matrix metalloproteinases (MMPs −2, −8, −9, and
−13), which also possess a Zn2+ cation at their active site, but
an inhibition of MMP activity could not be observed (data not
shown). This is in contrast to findings from Zhang and co-
workers, who introduce I2 and related compounds as gelatinase
inhibitors with nanomolar affinities.18,39
We found that the different substitution patterns of precursor
compounds 21−23 influence target affinity. Compounds 22
and 23 are substituted at the benzoyl moiety, while 21 is
substituted at the cinnamoyl moiety. This results in a higher
affinity of 22 and 23 to APN, which is also comparable to that
of the lead I2. In contrast, 21 only exhibits a negligible affinity
Optical imaging is a desirable technique for in vivo
diagnostics because it is a highly sensitive, inexpensive imaging
method that can potentially resolve relevant target structures in
vivo.40,41 Optical imaging allows specific tagging of particular
44
receptors,42 antibodies,43 genes,
or drugs,45 thereby
J
dx.doi.org/10.1021/bc400074w | Bioconjugate Chem. XXXX, XXX, XXX−XXX

Bioconjugate Chemistry
Article
(CD 13) in normal tissues and malignant neoplasms of epithelial and
lymphoid origin. J. Clin. Pathol. 47, 43−47.
(4) Kehlen, A., Gohring, B., Langner, J., and Riemann, D. (1998)
Regulation of the expression of aminopeptidase A, aminopeptidase N/
CD13 and dipeptidylpeptidase IV/CD26 in renal carcinoma cells and
renal tubular epithelial cells by cytokines and cAMP-increasing
mediators. Clin. Exp. Immunol. 111, 435−441.
(5) Surowiak, P., Drag, M., Materna, V., Suchocki, S., Grzywa, R.,
Spaczynski, M., Dietel, M., Oleksyszyn, J., Zabel, M., and Lage, H.
(2006) Expression of aminopeptidase N/CD13 in human ovarian
cancers. Int. J. Gynecol. Cancer 16, 1783−1788.
(6) Terauchi, M., Kajiyama, H., Shibata, K., Ino, K., Nawa, A.,
Mizutani, S., and Kikkawa, F. (2007) Inhibition of APN/CD13 leads
to suppressed progressive potential in ovarian carcinoma cells. BMC
Cancer 7, 140.
(7) Iguchi, K., Nakano, T., Usui, S., and Hirano, K. (2006)
Incadronate inhibits aminopeptidase N expression in prostatic PC-3
cells. Cancer Lett. 237, 223−233.
(8) Ishii, K., Usui, S., Sugimura, Y., Yoshida, S., Hioki, T., Tatematsu,
M., Yamamoto, H., and Hirano, K. (2001) Aminopeptidase N
regulated by zinc in human prostate participates in tumor cell
invasion. Int. J. Cancer 92, 49−54.
(9) Riemann, D., Gohring, B., and Langner, J. (1994) Expression of
aminopeptidase N/CD13 in tumour-infiltrating lymphocytes from
human renal cell carcinoma. Immunol. Lett. 42, 19−23.
(10) Stange, T., Kettmann, U., and Holzhausen, H. J. (2000)
Immunoelectron microscopic demonstration of the membrane
proteases aminopeptidase N/CD13 and dipeptidyl peptidase IV/
CD26 in normal and neoplastic renal parenchymal tissues and cells.
Eur. J. Histochem. 44, 157−164.
(11) Kehlen, A., Lendeckel, U., Dralle, H., Langner, J., and Hoang-
Vu, C. (2003) Biological significance of aminopeptidase N/CD13 in
thyroid carcinomas. Cancer Res. 63, 8500−8506.
(12) Severini, G., Gentilini, L., and Tirelli, C. (1991) Diagnostic
evaluation of alanine aminopeptidase as serum marker for detecting
cancer. Cancer Biochem. Biophys. 12, 199−204.
(13) Bhagwat, S. V., Lahdenranta, J., Giordano, R., Arap, W.,
Pasqualini, R., and Shapiro, L. H. (2001) CD13/APN is activated by
angiogenic signals and is essential for capillary tube formation. Blood
97, 652−659.
(14) Bhagwat, S. V., Petrovic, N., Okamoto, Y., and Shapiro, L. H.
(2003) The angiogenic regulator CD13/APN is a transcriptional
target of Ras signaling pathways in endothelial morphogenesis. Blood
101, 1818−1826.
measuring compound biodistribution and pharmacokinetics
and hence leading to a better understanding of these processes.
Fluorescence reflectance imaging (FRI) and fluorescence
mediated tomography (FMT) as emerging optical imaging
techniques have been shown to be capable of resolving
fluorescence signatures three-dimensionally and (semi)-
quantitatively.46 For the design of APN target-specific
fluorochromes, an APN ligand has to be combined with a
fluorescent dye. In an optimal setting, the attachment of the dye
to the ligand molecule does not alter or influence the binding
properties of the ligand. Because of the apparent differences
between 21 and 23, we chose to label both compounds in order
to more closely evaluate their different behavior. The resulting
tracers Cy 5.5-21 and Cy 5.5-23 were tested in vitro on BT-549
and BT-20 cells, where the apparent differences of the two
compounds were also observed. Human breast cancer cell line
BT-549 binds Cy 5.5-23 but not Cy 5.5-21. Predosing
experiments with bestatin as a blocking agent suggest specific
binding of Cy 5.5-23 to APN on the cell surface, supporting the
findings from cell toxicity examinations and confirming the
assumption that dye modification of 23 does not disrupt target
binding.
CONCLUSION
■
In conclusion, to the best of our knowledge, we here report for
the first time the synthesis and characterization of a
nonpeptidic, small-molecular fluorescent tracer with high
affinity to aminopeptidase N (APN/CD13). The in vitro
evaluation of this tracer shows promising results because of its
high specificity to the target structure and a low residual (=
non-APN-mediated) toxicity. These favorable characteristics
will now be further evaluated in in vivo experiments with
murine models of high APN expression. Further improvement
of the tracer, including spacer-length, hydrophilicity, and
flexibility and careful characterization of APN/CD13 expression
levels in tissues, will warrant better understanding of APN
pathophysiology.
AUTHOR INFORMATION
■
Corresponding Author
(15) Hashida, H., Takabayashi, A., Kanai, M., Adachi, M., Kondo, K.,
Kohno, N., Yamaoka, Y., and Miyake, M. (2002) Aminopeptidase N is
involved in cell motility and angiogenesis: its clinical significance in
human colon cancer. Gastroenterology 122, 376−386.
*Phone: +49 251 8356156. Fax: +49 251 8352067. E-mail:
carsten.hoeltke@uni-muenster.de.
Notes
(16) von Wallbrunn, A., Waldeck, J., Holtke, C., Zuhlsdorf, M.,
̈
̈
The authors declare no competing financial interest.
Mesters, R., Heindel, W., Schafers, M., and Bremer, C. (2008) In vivo
̈
optical imaging of CD13/APN-expression in tumor xenografts. J.
ACKNOWLEDGMENTS
■
Biomed. Opt. 13, 011007.
Financial support by the German Research Foundation
(Deutsche Forschungsgemeinschaft, DFG), Sonderforschungs-
bereich SFB 656, subprojects A4 and C6, and from the
Interdisciplinary Center for Clinical Research (Interdiszipli-
(17) Holtke, C., von Wallbrunn, A., Kopka, K., Schober, O., Heindel,
̈
W., Schafers, M., and Bremer, C. (2007) A fluorescent photoprobe for
̈
the imaging of endothelin receptors. Bioconjugate Chem 18, 685−694.
(18) Li, X., Li, Y., and Xu, W. (2006) Design, synthesis, and
evaluation of novel galloyl pyrrolidine derivatives as potential anti-
tumor agents. Bioorg. Med. Chem. 14, 1287−1293.
nares Zentrum fur Klinische Forschung, IZKF, Core-Units
̈
̈
OPTI and SmAP) is gratefully acknowledged. We thank
(19) van Hensbergen, Y., Broxterman, H. J., Hanemaaijer, R., Jorna,
A. S., van Lent, N. A., Verheul, H. M., Pinedo, H. M., and Hoekman,
K. (2002) Soluble aminopeptidase N/CD13 in malignant and
nonmalignant effusions and intratumoral fluid. Clin. Cancer Res. 8,
3747−3754.
(20) Tahtaoui, C., Parrot, I., Klotz, P., Guillier, F., Galzi, J. L., Hibert,
M., and Ilien, B. (2004) Fluorescent pirenzepine derivatives as
potential bitopic ligands of the human M1 muscarinic receptor. J. Med.
Chem. 47, 4300−4315.
(21) Cai, W., and Chen, X. (2008) Multimodality molecular imaging
of tumor angiogenesis. J. Nucl. Med. 49 (Suppl2), 113S−128S.
Marlena Brink, Ingrid Otto-Valk, Klaudia Niepagenkamper, and
̈
Ina Winkler for technical assistance.
REFERENCES
■
(1) Carmeliet, P. (2003) Angiogenesis in health and disease. Nature
Med. 9, 653−660.
(2) Folkman, J. (2007) Angiogenesis: an organizing principle for drug
discovery? Nature Rev. Drug Discovery 6, 273−286.
(3) Dixon, J., Kaklamanis, L., Turley, H., Hickson, I. D., Leek, R. D.,
Harris, A. L., and Gatter, K. C. (1994) Expression of aminopeptidase-n
K
dx.doi.org/10.1021/bc400074w | Bioconjugate Chem. XXXX, XXX, XXX−XXX

Bioconjugate Chemistry
Article
(22) Backer, M. V., Levashova, Z., Patel, V., Jehning, B. T., Claffey,
K., Blankenberg, F. G., and Backer, J. M. (2007) Molecular imaging of
VEGF receptors in angiogenic vasculature with single-chain VEGF-
based probes. Nature Med. 13, 504−509.
(23) Beer, A. J., and Schwaiger, M. (2008) Imaging of integrin
alphavbeta3 expression. Cancer Metastasis Rev 27, 631−644.
(24) Pasqualini, R., Koivunen, E., and Ruoslahti, E. (1995) A peptide
isolated from phage display libraries is a structural and functional
mimic of an RGD-binding site on integrins. J. Cell Biol. 130, 1189−
1196.
(40) Bremer, C., Ntziachristos, V., Mahmood, U., Tung, C. H., and
Weissleder, R. (2001) Progress in optical imaging. Radiologe 41, 131−
137.
(41) Ntziachristos, V., Bremer, C., Graves, E. E., Ripoll, J., and
Weissleder, R. (2002) In vivo tomographic imaging of near-infrared
fluorescent probes. Mol. Imaging 1, 82−88.
(42) Chen, W. T., Khazaie, K., Zhang, G., Weissleder, R., and Tung,
C. H. (2005) Detection of dysplastic intestinal adenomas using a
fluorescent folate imaging probe. Mol. Imaging 4, 67−74.
(43) Ballou, B., Fisher, G. W., Waggoner, A. S., Farkas, D. L., Reiland,
J. M., Jaffe, R., Mujumdar, R. B., Mujumdar, S. R., and Hakala, T. R.
(1995) Tumor labeling in vivo using cyanine-conjugated monoclonal
antibodies. Cancer Immunol. Immunother. 41, 257−263.
(44) Bremer, C., and Weissleder, R. (2001) In vivo imaging of gene
expression. Acad. Radiol. 8, 15−23.
(45) Arttamangkul, S., Alvarez-Maubecin, V., Thomas, G., Williams, J.
T., and Grandy, D. K. (2000) Binding and internalization of
fluorescent opioid peptide conjugates in living cells. Mol. Pharmacol.
58, 1570−1580.
(46) Ntziachristos, V., Bremer, C., and Weissleder, R. (2003)
Fluorescence imaging with near-infrared light: new technological
advances that enable in vivo molecular imaging. Eur. Radiol. 13, 195−
208.
(47) Li, X., Wang, Y., Wu, J., Li, Y., Wang, Q., and Xu, W. (2009)
Novel aminopeptidase N inhibitors derived from antineoplaston AS2−
5 (Part II). Bioorg. Med. Chem. 17, 3061−3071.
(48) Fieser, L. F., and Fieser, M. (1967) Reagents for Organic Synthesis
p 478, Vol. 1, Wiley, New York.
(25) Beer, A. J., Kessler, H., Wester, H. J., and Schwaiger, M. (2011)
PET Imaging of Integrin alphaVbeta3 Expression. Theranostics 1, 48−
57.
(26) Lanzardo, S., Conti, L., Brioschi, C., Bartolomeo, M. P., Arosio,
D., Belvisi, L., Manzoni, L., Maiocchi, A., Maisano, F., and Forni, G.
(2011) A new optical imaging probe targeting alphaVbeta3 integrin in
glioblastoma xenografts. Contrast Media Mol. Imaging 6, 449−458.
(27) Ye, Y., Bloch, S., Xu, B., and Achilefu, S. (2006) Design,
synthesis, and evaluation of near infrared fluorescent multimeric RGD
peptides for targeting tumors. J. Med. Chem. 49, 2268−2275.
(28) Beer, A. J., Haubner, R., Sarbia, M., Goebel, M., Luderschmidt,
S., Grosu, A. L., Schnell, O., Niemeyer, M., Kessler, H., Wester, H. J.,
Weber, W. A., and Schwaiger, M. (2006) Positron emission
tomography using [18F]Galacto-RGD identifies the level of integrin
alpha(v)beta3 expression in man. Clin. Cancer Res. 12, 3942−3949.
(29) Buehler, A., van Zandvoort, M. A., Stelt, B. J., Hackeng, T. M.,
Schrans-Stassen, B. H., Bennaghmouch, A., Hofstra, L., Cleutjens, J. P.,
Duijvestijn, A., Smeets, M. B., de Kleijn, D. P., Post, M. J., and de
Muinck, E. D. (2006) cNGR: a novel homing sequence for CD13/
APN targeted molecular imaging of murine cardiac angiogenesis in
vivo. Arterioscler. Thromb. Vasc. Biol. 26, 2681−2687.
(30) Bauvois, B., and Dauzonne, D. (2006) Aminopeptidase-N/
CD13 (EC 3.4.11.2) inhibitors: chemistry, biological evaluations, and
therapeutic prospect. Med. Res. Rev. 26, 88−130.
(31) Xu, W., and Li, Q. (2005) Progress in the development of
aminopeptidase N (APN/CD13) inhibitors. Curr. Med. Chem.:
Anticancer Agents 5, 281−301.
(32) Ichinose, Y., Genka, K., Koike, T., Kato, H., Watanabe, Y., Mori,
T., Iioka, S., Sakuma, A., and Ohta, M. (2003) Randomized double-
blind placebo-controlled trial of bestatin in patients with resected stage
I squamous-cell lung carcinoma. J. Natl. Cancer Inst. 95, 605−610.
(33) Bieker, R., Kessler, T., Schwoppe, C., Padro, T., Persigehl, T.,
̈
Bremer, C., Dreischaluck, J., Kolkmeyer, A., Heindel, W., Mesters, R.
M., and Berdel, W. E. (2009) Infarction of tumor vessels by NGR-
peptide-directed targeting of tissue factor: experimental results and
first-in-man experience. Blood 113, 5019−5027.
(34) Fournie-Zaluski, M. C., Coric, P., Turcaud, S., Bruetschy, L.,
Lucas, E., Noble, F., and Roques, B. P. (1992) Potent and systemically
active aminopeptidase N inhibitors designed from active-site
investigation. J. Med. Chem. 35, 1259−1266.
(35) Chauvel, E. N., Llorens-Cortes, C., Coric, P., Wilk, S., Roques,
B. P., and Fournie-Zaluski, M. C. (1994) Differential inhibition of
aminopeptidase A and aminopeptidase N by new beta-amino thiols. J.
Med. Chem. 37, 2950−2957.
(36) Chen, H., Roques, B. P., and Fournie-Zaluski, M. C. (1999)
Design of the first highly potent and selective aminopeptidase N (EC
3.4.11.2) inhibitor. Bioorg. Med. Chem. Lett. 9, 1511−1516.
(37) Zhang, X., Fang, H., Zhang, J., Yuan, Y., and Xu, W. (2011)
Recent advance in aminopeptidase N (APN/CD13) inhibitor research.
Curr. Med. Chem. 18, 5011−21.
(38) Alford, R., Simpson, H. M., Duberman, J., Hill, G. C., Ogawa,
M., Regino, C., Kobayashi, H., and Choyke, P. L. (2009) Toxicity of
organic fluorophores used in molecular imaging: literature review. Mol.
Imaging 8, 341−354.
(39) Zhang, L., Zhang, J., Fang, H., Wang, Q., and Xu, W. (2006)
Design, synthesis and preliminary evaluation of new cinnamoyl
pyrrolidine derivatives as potent gelatinase inhibitors. Bioorg. Med.
Chem. 14, 8286−8294.
L
dx.doi.org/10.1021/bc400074w | Bioconjugate Chem. XXXX, XXX, XXX−XXX