Diethylstilbestrol-scaffold-based pregnane X receptor modulators

Article abstract of DOI:10.1016/j.ejmech.2015.09.005

Due to its function as a regulator of drug-metabolizing enzymes and transporters, pregnane X receptor (PXR) represents an important factor involved in drug metabolism. In this work, we describe the discovery of diethylstilbestrol-based PXR modulators, which were designed from marine sulfated steroids with PXR agonistic activity, solomonsterols A and B, and our recently reported bazedoxifene scaffold-derived PXR antagonists. The methylated diethylstilbestrol derivative 1 displayed potent PXR agonistic activity with an EC₅₀ value of 10.5 μM, whereas compounds 3, 4 and 6 (IC₅₀ for 6 = 27.4 μM) and diethylstilbestrol (2) itself (IC₅₀ = 14.6 μM) exhibited PXR antagonistic effects in HepG2 cells. The PXR modulatory effects of the synthesized diethylstilbestrol derivatives were further confirmed by the induction of PXR-regulated CYP3A4 expression with compound 1, as well as by the inhibition of the rifaximin-promoted up-regulation of CYP3A4 expression with 2 and its derivative 6.

Full text of DOI:10.1016/j.ejmech.2015.09.005

European Journal of Medicinal Chemistry 103 (2015) 551e562
Contents lists available at ScienceDirect
European Journal of Medicinal Chemistry
journal homepage: http://www.elsevier.com/locate/ejmech
Research paper
Diethylstilbestrol-scaffold-based pregnane X receptor modulators
a
b
ꢀ ꢀ a
ꢀ a
ꢀ
Ziga Hodnik , Tihomir Tomasic , Domen Smodis , Claudio D'Amore ,
Lucija Peterlin Masic , Stefano Fiorucci 1, Danijel Kikelj a
University of Ljubljana, Faculty of Pharmacy, Askerceva 7, 1000 Ljubljana, Slovenia
b
,
, *, 1
ꢀ ꢀ a
a
ꢀ
ꢀ
b
ꢁ
University of Perugia, Dipartimento di Medicina Clinica e Sperimentale, Nuova Facultadi Medicina e Chirurgia, S. Andrea delle Fratte, 06132 Perugia, Italy
a r t i c l e i n f o
a b s t r a c t
Article history:
Due to its function as a regulator of drug-metabolizing enzymes and transporters, pregnane X receptor
(PXR) represents an important factor involved in drug metabolism. In this work, we describe the dis-
covery of diethylstilbestrol-based PXR modulators, which were designed from marine sulfated steroids
with PXR agonistic activity, solomonsterols A and B, and our recently reported bazedoxifene scaffold-
derived PXR antagonists. The methylated diethylstilbestrol derivative 1 displayed potent PXR agonistic
Received 28 April 2015
Received in revised form
21 July 2015
Accepted 4 September 2015
Available online 8 September 2015
activity with an EC50 value of 10.5
diethylstilbestrol (2) itself (IC50 ¼ 14.6
m
M, whereas compounds 3, 4 and 6 (IC50 for 6 ¼ 27.4
mM) and
m
M) exhibited PXR antagonistic effects in HepG2 cells. The PXR
Keywords:
Pregnane X receptor
PXR agonist
PXR antagonist
Diethylstilbestrol
Mimetic
modulatory effects of the synthesized diethylstilbestrol derivatives were further confirmed by the in-
duction of PXR-regulated CYP3A4 expression with compound 1, as well as by the inhibition of the
rifaximin-promoted up-regulation of CYP3A4 expression with 2 and its derivative 6.
© 2015 Elsevier Masson SAS. All rights reserved.
Solomonsterol
1. Introduction
expression of phase III efflux ATP-binding cassette (ABC) drug
transporters, such as breast cancer resistance protein (BCRP), P-
The binding of a ligand to a member of a nuclear receptor family
initiates a process that results in the induction of enzymes involved
in metabolism, growth, homeostasis, reproduction and inflamma-
tion [1]. Pregnane X receptor (PXR), a member of the nuclear re-
ceptor subfamily NR1I, is activated by lithocholic acid and protects
tissues against the toxic effects of bile acids [2]. As a regulator of
drug-metabolizing enzymes and transporters, PXR also functions as
a xenobiotic sensor and as a leading transcriptional regulator of
drug metabolism [3e5].
glycoprotein (P-gp) and multiple resistance drug protein (MRP) [4].
As a member of the nuclear receptor family, PXR shares common
structure with other nuclear receptors, containing a DNA-binding
domain and a ligand-binding domain (LBD) [5,6]. The unique LBD
of PXR is defined by a spherical and flexible binding pocket that has
a volume ranging from 1150 to more than 1600 Å3 and is capable of
binding a diverse array of hydrophobic molecules with the ability to
form hydrogen bonds [7]. Agonist binding to LBD is followed by the
conformational changes of ligand-dependent activation function 2
(AF-2) and subsequent dissociation of corepressor proteins. The
binding of transcriptional coactivators, which finalizes the assem-
bly of proteins that bind to promoter regions of its target genes as a
heterodimer with the retinoid X receptor, completes the process
and initiates the transcription [8]. In contrast, PXR antagonists
suppress the transcription of PXR target genes by disrupting the
binding of coactivators to the AF-2 region of LBD [8e10].
PXR is predominantly located in the liver, small intestines and
colon, where it regulates the expression of phase
I drug-
metabolizing enzymes, such as CYP2B6, CYP2C8, CYP2C9,
CYP2C19 and CYP3A4, and phase II enzymes, such as glutathione-S-
transferase, acetyltransferase, sulfotransferase, methyltransferase
and uridine 5’-diphosphoglucuronosyl-transferase [3]. Further-
more, it also regulates drug elimination by controlling the
Inflammatory bowel disease (IBD), comprising ulcerative colitis
and Crohn's disease, is ranked as one of the five most frequent
gastrointestinal diseases in the USA [11]. A potent PXR agonist
rifaximin displays protective effects against IBD in a colon cell line
and in a mouse model in which IBD was initiated with trini-
trobenzenesulfonic acid or sodium salt of dextran sulfate [12,13]. In
contrast, the protective effect of rifaximin was not evident in PXR-
Abbreviations used: ABC, ATP-binding cassette; AF-2, activation function 2;
BCRP, breast cancer resistance protein; DES, diethylstilbestrol; MRP, multiple
resistance drug protein.
* Corresponding author.
E-mail address: danijel.kikelj@ffa.uni-lj.si (D. Kikelj).
Contributed equally to this work.
1
http://dx.doi.org/10.1016/j.ejmech.2015.09.005
0223-5234/© 2015 Elsevier Masson SAS. All rights reserved.

ꢀ
552
Z. Hodnik et al. / European Journal of Medicinal Chemistry 103 (2015) 551e562
null IBD mice [12]. Solomonsterol A, a sulfated sterol with PXR
agonistic activity isolated from the marine sponge Theonella swin-
hoei, in a recent study exhibited a protective effect against clinical
signs and symptoms of ulcerative colitis in human PXR-transgenic
fitting a large and flexible binding pocket and/or binding to a
presently unknown part of the receptor surface [8,38]. Indeed,
recent studies propose that, in addition to the binding pocket, the
AF-2 helix could provide a surface for the binding of the PXR an-
tagonists coumestrol [39] and ketoconazole [9].
mice, due to the reduction of level of TNFa, a signature cytokine
for this disease [14]. Both studies therefore highlight PXR agonists
as promising agents for the treatment of inflammatory bowel
disease.
In the present work, we report the discovery of novel
diethylstilbestrol-derived PXR modulators by application of a
combination of ligand-based design, scaffold hopping and ster-
oidomimetic approach to the PXR agonistic-marine sulfated ste-
roids solomonsterols A and B [16] and to our recently reported
bazedoxifene-scaffold-based PXR antagonists [37]. The strategy
involved the substitution of the steroid core of solomonsterols A
and B with synthetically more favorable scaffold of diethylstilbes-
trol (DES), which is a well-known steroidomimetic surrogate in
synthetic estrogens (Figure S1) [40,41] and offers manifold deriv-
atization opportunities at both hydroxyl groups. Furthermore, to
study the structure-activity relationship of the DES-based analogs
as PXR modulators, we evaluated the impact of (i) sulfate ester
formation, (ii) O-alkylation at both hydroxyl groups, (iii) acetylation
of the terminal hydroxyl groups and (iv) length of the alkylene
linker at positions 4 and 40 of the DES scaffold on modulation of PXR
(Fig. 3A).
The study performed in HepG2 cell line revealed diethylstil-
bestrol dimethyl ether (1) as a potent PXR agonist, whereas DES (2)
itself and the DES derivatives 3, 4 and 6, with O-acetoxyalkyl and O-
hydroxyalkyl side chains of varying length displayed PXR antago-
nistic activity. In contrast to previous studies, which reported DES
as a weak PXR agonist with the ability to increase CYP3A4
expression in DPX2 and HG5LN cells [42e44], surprisingly, DES was
identified as a potent PXR antagonist in our assay using the PXR-
transfected HepG2 cell line. Beside identification of novel micro-
molar PXR agonist 1 and novel PXR antagonists 3, 4 and 6, this
study highlights suitability of diethylstilbestrol scaffold and ster-
oidomimetic approach for design of PXR modulators.
The currently known PXR agonists include structurally diverse
molecules, such as semisynthetic antibiotic rifaximin [13,15] and
the marine sulfated sterols solomonsterol A and solomonsterol B
[14,16,17] isolated from Theonella swinhoei. Moreover, various ma-
rine sterols from Theonella sponges and Sinularia kavarattiensis
[18e20], including preconicasterol, were also reported as PXR ag-
onists recently. The list of PXR agonists also comprises the
oxygenated polyketides from Plakinastrella mamillaris [21], such as
gracilioether J, the calcium channel blockers nicardipine, nifedi-
pine, felodipine and isradipine [22], the anti-inflammatory drug
dexamethasone [23], the cholesterol-lowering agent SR12813 and
others [24e26] (Fig. 1).
PXR is overexpressed in breast [27], ovarian [28], endometrial
[29], prostate [30], colon [31] and osteosarcoma [32] cancer cells,
and recent studies highlight PXR as an important player in the
multidrug resistance of cancer cells to chemotherapeutic agents
[26,30,31,33]. The administration of the potent PXR agonist
SR12813 together with the anticancer agent vinblastine or pacli-
taxel to the prostate cancer cell line PC-3 resulted in decreased
efficiency of both anticancer agents, most likely due to the elevated
expression of P-gp [30]. In contrast, the chemosensitivity of colo-
rectal cancer cells to irinotecan was increased in the presence of the
PXR antagonist sulforaphane, which highlights the potential of PXR
antagonists to overcome multidrug resistance in cancer chemo-
therapy [31].
Although most of the currently known PXR ligands display
agonistic activity, a small number of compounds that bind to PXR
act as PXR antagonists (Fig. 2). Ecteinascidin-743, the first reported
PXR antagonist, suppresses SR12813-and paclitaxel-induced PXR
activation [34]. The biguanide antidiabetic agent metformin sup-
presses PXR-regulated CYP3A4 expression [35], whereas com-
pound SPB3255 (IC50 ¼ 850 nM) presents the most potent PXR
antagonist identified to date [36]. The list continues with our
recently reported bazedoxifene scaffold-based PXR antagonists
(compounds I and II), which suppress PXR-regulated CYP3A4
expression, as well as PXR expression [37]. The lack of success in the
structure-based design of novel PXR antagonists illustrates that, in
contrast to PXR agonists, the design and discovery of PXR antago-
nists presents a demanding task due to the difficult combination of
2. Results and discussion
2.1. Design
Solomonsterols A and B, isolated from Theonella swinhoei, are
marine sulfated steroids possessing PXR agonistic activity [16].
Using a steroidomimetic approach, we have recently replaced
their steroid scaffold by the 3-methyl-2-phenyl-1H-indole moiety
and discovered their non-sulfated analogs displaying PXR antag-
onistic activity [37]. In the present study, combining the ster-
oidomimetic and scaffold hopping approach, we have replaced the
steroid core of solomonsterols A and B by diethylstilbestrol, a well-
Fig. 1. Structures of some PXR agonists.

ꢀ
Z. Hodnik et al. / European Journal of Medicinal Chemistry 103 (2015) 551e562
553
Fig. 2. Structures of currently known PXR antagonists.
known steroidomimetic surrogate (Figure S1), to obtain a focused
library of analogs of PXR agonists solomonsterols A and B and of
our bazedoxifene-based PXR antagonists (Fig. 3A). Since solo-
monsterols A and B displayed PXR agonistic activity and their non-
sulfated bazedoxifene-scaffold-based analogs possessed PXR
antagonistic activity, we have designed and synthesized both their
non-sulfated (2e8) and sulfated (9e12) DES-scaffold-based ana-
logs (Scheme 1) and evaluated them for PXR agonistic and
antagonistic activities. The three-dimensional similarity of the
designed DES-scaffold-based PXR modulators, solomonsterol B
and bazedoxifene-scaffold-based PXR antagonist I was studied
using the ROCS (OpenEye Scientific Software, Inc.) [45e47]
method of molecular shape and atom type comparison. The
ROCS results (Table S1 in the Supporting Information) showed that
DES (2) overlays well with the bazedoxifene-scaffold-based
antagonist I, thus highlighting the DES scaffold as appropriate
for the design of novel PXR modulators (Fig. 3B). Moreover, the
sulfated DES analog 10 (n ¼ 2, R ¼ SO3eNaþ) displayed good shape
similarity to solomonsterol B with a good overlay of alkyl chains
bearing a sulfate group with the only difference on the left-hand
side of the molecules, where one of the sulfate moieties of solo-
monsterol B does not have its counterpart in DES derivative 10
(Fig. 3C). Overall, designed compounds 2e12 share better shape
than color similarity to compound I and solomonsterols A and B
A
B
C
Fig. 3. (A) Design of the diethylstilbestrol-scaffold-based PXR modulators starting from the PXR agonists solomonsterols A and B [16] and our recently discovered bazedoxifene
scaffold-based PXR antagonists [37]. (B) Overlay of bazedoxifene-scaffold-based PXR antagonist I (for structure see Fig. 2) with diethylstilbestrol (2; in orange). Compound I is
represented by green sticks, its corresponding shape is shown in grey, and its pharmacophoric features are colored red for H-bond acceptors, blue for H-bond donors and green for
rings. (C) Overlay of solomonsterol B with the designed diethylstilbestrol-scaffold-based PXR modulator 10 (n ¼ 2, R ¼ SO3eNaþ) in cyan. Solomonsterol B is represented by green
sticks, its corresponding shape is shown in grey, and its pharmacophoric features are colored red for H-bond acceptors, blue for H-bond donors, green for rings and yellow for
hydrophobic groups. Both overlays were obtained using ROCS (OpenEye Scientific Software, Inc.) [45e47]. (For interpretation of the references to colour in this figure legend, the
reader is referred to the web version of this article.)

ꢀ
554
Z. Hodnik et al. / European Journal of Medicinal Chemistry 103 (2015) 551e562
Scheme 1. Reagents and conditions: (a) BBr3, CH2Cl2, ꢀ78 ꢁC, then rt, 2 h; (b) for compound 3: 2-bromoethyl acetate, Cs2CO3, acetone, 60 ꢁC, 48 h; for compound 4: 3-chloropropyl
acetate, NaH, DMF, 60 ꢁC, 18 h; for compound 5: 4-bromobutyl acetate, Cs2CO3, acetone, 60 ꢁC, 48 h; (c) 1 M NaOH, MeOH, rt, 2 h; (d) chlorosulfonic acid, pyridine, rt, 24 h; then
NaOH, pyridine, rt, 24 h.
(Table S1 in the Supporting Information).
assay with the PXR-transfected HepG2 cell line in the presence of
rifaximin (10 M). In contrast to O-methyl-protected DES analog 1,
m
which was identified as a potent PXR agonist in the first assay, O-
acetyl-protected derivatives 3 and 4 were identified as promising
PXR antagonists (Fig. 4B). This finding suggests that, in combination
with both linkers that increase the molecule's length, the ester
groups of analogs 3 and 4 could provide interactions with the re-
ceptor that are favorable for antagonistic activity. It is also possible
that partial ester hydrolysis in the test system could contribute to
the observed activity of analogs 3 and 4 because the analog 6
exhibited even more evident PXR antagonistic activity. The analog 6
and especially DES (2) present the most potent PXR antagonists in
this series of compounds, in agreement with our previous results
for bazedoxifene scaffold-based PXR antagonists [37], where the
antagonistic activity of hydroxylated compounds was inversely
correlated to the length of the molecule. Furthermore, the mole-
cule's length seems to play a role also in cytotoxicity and solubility
2.2. Chemistry
In order to obtain DES (2) as the key intermediate in the syn-
thesis of the envisaged series of derivatives to explore the
structure-activity relationship, the methyl ether-protected com-
pound 1 was synthesized as previously described [48]. The latter
was O-deprotected with boron tribromide in dichloromethane to
give 2 in good yield. The acetyl-protected DES derivatives 3 and 5
were obtained in a reaction of 2 with the corresponding bromoalkyl
acetates and cesium carbonate as the base. The acetyl-protected
DES derivative 4 was synthesized in a similar manner using 3-
chloropropyl acetate and sodium hydride as the base because ce-
sium carbonate did not yield any product in this case. The subse-
quent hydrolysis of diesters 3e5 yielded O-hydroxyalkyl derivatives
6e8. DES (2) and compounds 6e8 were treated with chlorosulfonic
acid in anhydrous pyridine and then subjected to sodium
hydroxide-driven salt formation to give sulfate ester salts 9e12 in
good yields (Scheme 1).
issues at 50 mM. Morphological analysis revealed the cytotoxicity of
hydroxylated analogs 7 and 8, which possess three- and four-
carbon atoms linkers, whereas the O-acetyl analog 5 with four-
carbon atoms linkers displayed poor solubility. Consequently,
both issues resulted in unsuccessful evaluation of the PXR antag-
onistic activities of analogs 5, 7 and 8. Finally, the sulfated analogs
9e12 were devoid of any noteworthy PXR antagonistic activity,
which is again in agreement with the results of our previous study
on bazedoxifene-scaffold-based PXR antagonists, in which O-sul-
fatation was detrimental to antagonistic activity [37]. Taking into
account the reported PXR agonistic activity of sulfated sterols
solomonsterols A and B measured in the same assay, the failure to
observe PXR activity with the sulfated analogs 9e12 does not seem
to be due to issues involving their cell penetration. Molecular
docking of sulfated compounds 9e12 predicted interaction be-
tween their sulfate groups and Lys210 and Ser247 side chains
(Figure S3), similarly as observed in the case of solomonsterols A
and B. The important difference leading to the absence of PXR
agonistic activity of 9e12 might be the lack of interaction with
His407, which is formed in the case of solomonsterols A and B.
The agonistic activity of diethylstilbestrol dimethyl ether (1) was
further quantified by a concentration-response transactivation
experiment in HepG2 cells. The concentration-response curve
2.3. Biological evaluation
Because solomonsterols A and B have been identified as PXR
agonists [16] and our previously reported bazedoxifene scaffold-
based analogs displayed PXR antagonistic activity [37], we evalu-
ated DES (2) and its derivatives 1 and 3e12 for PXR agonistic, as
well as for PXR antagonistic activity. A luciferase reporter assay was
performed on a human hepatocarcinoma cell line (HepG2) that was
transiently transfected with the pSG5-PXR, pSG5-RXR, pGL4.70-
Renilla and pGL3(henance) PXRE vectors (c.f. Experimental
section).
Among the hydroxylated DES derivatives 6e8, only compounds
7 and 8, with three and four carbon atoms linkers, displayed a slight
activation of PXR, whereas the O-acetyl derivatives 3e5 did not
exhibit any PXR agonistic activity at 10
mM compared with the
negative control (Fig. 4A). The sulfated analogs 9e12 did not display
any PXR agonistic activity either, despite possessing sulfate ester
groups similarly to PXR agonists solomonsterols A and B [16]. On
the contrary, diethylstilbestrol dimethyl ether (1) displayed
revealed the concentration-dependent agonistic activity of
(EC50 ¼ 10.5 M), which exhibits a slightly higher potency compared
M) (Fig. 5A). The quantification of the
antagonistic activities of DES (2) and its derivative 6 was also per-
formed in HepG2 cells. Both compounds exhibited concentration-
1
promising PXR agonistic activity at 10 mM, comparable to that of a
m
potent PXR agonist rifaximin [15], which was used as a positive
control. Surprisingly, DES (2) was devoid of PXR agonistic activity in
HepG2 cells, although previous studies reported DES as a weak PXR
agonist in other cell lines [42e44].
with rifaximin (EC50 ¼ 11.2
m
dependent antagonistic effects with IC50 values of 14.6
mM and
The series of compounds 1e12 was further tested for PXR
27.4 M, respectively (Fig. 5B and C). The higher potency of DES (2)
m
antagonism at 50 mM concentration using the luciferase reporter

ꢀ
Z. Hodnik et al. / European Journal of Medicinal Chemistry 103 (2015) 551e562
555
A
30
20
10
0
*
*
NT
R
1
2
3
4
5
6
7
8
9
10
11
12
B
30
20
10
0
#
*
#
#
#
#
NT
R
1
2
3
4
6
9
10
11
12
R
Fig. 4. (A) Luciferase reporter assay performed in HepG2 cells transiently transfected with the full-length PXR, RXR, Renilla and canonical PXRE vectors and stimulated for 18 h with
rifaximin (R) alone or 1e12 (10 M) and (B) with 10 M rifaximin (R) alone or in combination with 1e12 (50 M; results not shown for 5 due to its poor solubility and for 7 and 8 due
m
m
m
to detected cytotoxicity).*p < 0.05 vs. non-treated (NT); #p < 0.05 vs. rifamimin (R).
compared to its O-substituted derivatives correlates with the results
for our recently reported series of bazedoxifene scaffold-based PXR
antagonists [37], in which 4-(5-hydroxy-3-methyl-1H-indol-2-yl)
which were mostly ranked lower than those of the first cluster, no
hydrogen bonds were observed between Lys210, Ser247, His407
and the ligand methoxy groups. Molecular docking calculations of
compounds 2e12 predicted similar binding of their DES scaffold
and the formation of hydrogen bonds with Lys210 and Ser247 and
methoxy groups of compounds 3, 4, 6e12. Therefore, we were not
able to differentiate between active and inactive compounds using
our docking protocol.
To further evaluate the determined PXR-antagonistic activity of
DES (2) and its most potent derivative 6 as well as PXR-agonistic
activity of 1, we measured their effects on the expression of PXR
and its primary target gene CYP3A4 (Fig. 7). The real-time PCR
analysis, which was performed on cDNA isolated from HepG2 cells,
revealed a slightly increased up-regulation of PXR expression by
benzene-1,2-diol (I; IC50 ¼ 11
mM) was the most potent compound
and O-hydroxyalkyl groups also lowered the PXR antagonistic
activity.
A plausible binding mode of the PXR agonist 1 was studied by
docking it to the PXR ligand-binding site using the GOLD [49]
software. Whereas the docking of solomonsterol A to the PXR
ligand-binding pocket displayed ionic interactions with Lys210 (24-
O-sulfate), hydrogen bonds with Ser247 (3-O-sulfate) and His407
(2-O-sulfate), as well as several hydrophobic interactions between
the steroidal nucleus and the protein [16,50], the binding of PXR
agonist 1 in the PXR ligand-binding pocket showed mostly hydro-
phobic interactions with the PXR residues and a hydrogen bond
between the ligand's methoxy group and Lys210 side chain (Fig. 6).
Analysis of all 25 docking poses revealed the presence of two main
clusters (RMSD < 1.5 Å) of docking solutions. The first cluster
contained 12 docking poses (Figure S2A) similar to the highest
ranked pose presented in Fig. 6, where in each case hydrogen bond
between Lys210 and one of the methoxy groups was observed.
Distance between the remaining methoxy group and Ser247 side
chain hydroxyl group was in the range between 3.4 and 4.8 Å,
which indicates that hydrogen bond with Ser247 might be present
taking into account also the flexibility of the PXR ligand-binding
pocket. In the second cluster of 10 docking poses (Figure S2B),
agonist 1 at 10
mM, as compared to that of rifaximin (10 mM).
Additionally, compound 1 significantly up-regulated CYP3A4 gene
expression, which despite being weaker than that obtained with
rifaximin, further illustrates its PXR agonistic potential (Fig. 7A). In
contrast to our previously reported bazedoxifene-scaffold-based
analogs [37], DES (2) and its analog 6 in particular, as PXR antag-
onists, slightly increased the rifaximin (10
mM)-induced up-
regulation of PXR expression at 25 M. Compounds 2 and 6 also
m
inhibited rifaximin-induced CYP3A4 expression, which highlights
their potential to suppress PXR-regulated phase I drug metabolism
in vitro (Fig. 7B). Furthermore, the inhibition of PXR-regulated
CYP3A4 expression confirms the PXR antagonistic effect of DES

ꢀ
556
Z. Hodnik et al. / European Journal of Medicinal Chemistry 103 (2015) 551e562
100
A
15
10
5
*
75
*
Rifaximin (EC :11.2
µM)
1 (EC :10.5 M)
µ
50
25
0
*
*
0
NT
1
10
50
M)
1
10
50
10
10
10
0
[M]
Rifaximin (
µ
1 (
µ
M)
100
75
50
25
0
B
*
8
6
4
2
0
#
2 (DES) (IC50:14.6
µM)
#
NT
R
*
10
25
50
10
10
0
[M]
2 (DES)
(
µ
M)
C
8
6
4
2
0
100
75
50
25
0
#
6 (IC : 27.4µM)
NT
R
10
25
50
10
10
0
[M]
6 (µM)
Fig. 5. Concentration-response curves for compounds 1 (A), 2 (B) and 6 (C). HepG2 cells were transfected as described above and stimulated with (A) increasing concentrations of
rifaximin or 1 (10 M) to determine the EC50 values or (B, C) with rifaximin (R) alone or in combination with increasing concentrations of 2 or 6 (10, 25 and 50 M) to determine the
m
m
IC50 values. *p < 0.05 vs. NT; #p < 0.05 vs. rifaximin (R).
(2) in HepG2 cells, which is in contrast to the results of previous
studies that described DES as a weak PXR agonist in different cell
lines [42e44].
diethylstilbestrol dimethyl ether (1) did not display any ER
agonistic activity at 10 M (Fig. 8A), which is in agreement with SAR
of natural and synthetic estrogens, claiming the importance of the
two hydroxy groups for ER agonistic activity. Transactivation
experiment performed with the ERR -transfected HepG2 cells us-
ing genistein, a selective ERR agonist as a positive control,
confirmed that compounds 1, 2 and 6 do not possess any note-
worthy ERR agonistic activity at 10 M (Fig. 8B). The data obtained
from the antagonism experiments revealed that at 50 M com-
pounds 1, 2 and 6 increased the 17 -estradiol ability to induce ER
activity (Fig. 8C), and reverted the genistein-induced trans-
activation of ERR although compounds 1 and 6 were found less
potent antagonists of ERR as compared to DES (2) (Fig. 8D).
In summary, among identified PXR modulators 1 and 6 derived
from diethylstilbestrol (2), PXR agonist 1 is devoid of ER agonistic
a
m
Since DES (2) is a-well known estrogen receptor agonist and also
a
inhibits estrogen-related receptor
ities [52e54], we have evaluated estrogen receptor
ERR binding of compounds 1 and 6 and compared them with the
b
(ERR
b) transcriptional activ-
b
a
(ER ) and
a
b
b
binding data obtained for DES (2). A luciferase reporter assay was
performed on HepG2 cells transiently transfected with the reporter
vectors p(UAS)5X-TKLuc, pGL4.70-Renilla and with different vectors
b
m
m
b
a
containing the ligand binding domain of ER
stream of the GAL4-DNA binding domain (pSG5-GAL4/ER
pFN26-GAL4/ERR ) (c.f. Experimental section). The derivative 6
displayed ER agonism but activation of ER at 10 M was weaker
as compared to DES (2) or 17 -estradiol. On the other hand,
a
or ERR
b
cloned up-
a
and
b
b
b
a
a
m
b
a

ꢀ
Z. Hodnik et al. / European Journal of Medicinal Chemistry 103 (2015) 551e562
557
Fig. 6. (A) Highest ranked GOLD-calculated binding pose of PXR agonist 1 (green sticks) in the PXR ligand-binding site (grey, PDB entry: 1M13). The hydrogen bonds between the
ligand and PXR residues (yellow) are presented as dashed black lines. The PXR residues forming hydrophobic interactions are presented as grey lines. The figure was prepared by
PyMOL [51]. (B) 2D diagram of interactions between compound 1 and PXR. The hydrogen bond with Lys210 (magenta) is represented in blue, and the hydrophobic interactions with
PXR residues (green) are colored cyan. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
activity characteristic for diethylstilbestrol but still retains a weak
ERR antagonistic activity as compared to DES. The new PXR
antagonist 6 possesses weaker ER agonistic and ERR antagonistic
also displayed dose-dependent PXR antagonistic activity
(IC50 ¼ 14.6 M) in HepG2 cells, which was further confirmed by
b
m
a
b
DES-induced inhibition of PXR-regulated CYP3A4 expression.
Interestingly, in contrast to these results DES had been identified as
a weak PXR agonist in DPX2 and HG5LN cells [42e44] and therefore
it would be interesting to test the library of our DES-scaffold-based
analogs also in these cell lines. As some H-bond donor and acceptor
groups were lost in the DES-scaffold-based compounds, introduc-
tion of additional hydroxyl groups on the phenyl rings of the DES
scaffold could be beneficial to increase activity of these compounds
on PXR. In comparison with diethylstilbestrol, the PXR agonist 1
activities in comparison to diethylstilbestrol.
3. Conclusion
Replacement of the bazedoxifene core of our previously re-
ported PXR antagonists [37] with the diethylstilbestrol scaffold, as
well as the incorporation of the structural motifs of solomonsterols
A and B resulted in novel PXR modulators with the ability to alter
PXR-regulated CYP3A4 expression. While the methylated analog 1
and PXR antagonist 6 possess weaker estrogen receptor
a agonistic
and estrogen-related receptor antagonistic activities, making
them and diethylstilbestrol scaffold good starting points for further
elaboration toward selective PXR modulators.
b
displayed PXR agonistic activity (EC50 ¼ 10.5
m
M) comparable to
that of rifaximin, analogs 3, 4 and 6 (IC50 for 6 ¼ 27.4
mM) exhibited
PXR antagonistic effects in HepG2 cells. Diethylstilbestrol (2) itself
A
3
1.5
*
*
2
1
0
1.0
0.5
0.0
NT
Rifaximin
NT
Rifaximin
1
1
B
1.5
1.0
0.5
0.0
3
*
#
2
1
0
#
NT
Rifaximin
NT
Rifaximin
2
6
2
6
Rifaximin
Rifaximin
Fig. 7. Real-time PCR analysis of the mRNA relative expression of PXR and its target gene CYP3A4. HepG2 cells were treated (A) with rifaximin (10
rifaximin (10 M) alone or in combination with DES (2) or 6 (25 M). The values are normalized relative to the level of GAPDH mRNA and are expressed relative to those levels
obtained in non-treated cells (NT), which were arbitrarily set to 1. *p < 0.05 vs. NT; #p < 0.05 vs. rifaximin.
mM) or 1 (10 mM) and (B) with
m
m

ꢀ
558
Z. Hodnik et al. / European Journal of Medicinal Chemistry 103 (2015) 551e562
Fig. 8. Luciferase reporter assay performed in HepG2 cells transiently transfected with (A, C) pSG5-GAL4/ER
stimulated for 18 h (A) with 17 -estradiol,1, 2 or 6 (10 M), (B) with genistein, 1, 2 or 6 (10 M), (C) with 10
with 10 M genistein alone or in combination with 1, 2 or 6 (50 M). *p < 0.05 vs. non-treated (NT); #p < 0.05 vs. 17b
a
m
and p(UAS)5x-TKLuc or (B, D) pFN26-GAL4/ERR
M 17 -estradiol alone or in combination with 1, 2 or 6 (50
-estradiol or genistein.
b
and p(UAS)5x-TKLuc,
b
m
m
b
mM), and (D)
m
m
4. Experimental section
mobile phase: 0.1% trifluoroacetic acid in water (A) and methanol
(B); gradient: 90% A to 30% A in 20 min, then 10 min 30% A; flow
4.1. General procedures
rate 1.0 mL/min; injection volume: 10 mL; Method B: Agilent 5m C18
column; mobile phase: water (A) and methanol (B); gradient: 70% A
All reagents were used as received from commercial sources
without further purification unless otherwise indicated. Analytical
TLC was performed on Merck silica gel (60 F 254) plates (0.25 mm)
and components visualized with staining reagents or UV light.
Column chromatography was carried out on silica gel 60 (particle
size 240e400 mesh). Reversed-phase column chromatography was
performed on Biotage Isolera One system, using Biotage SNAP KP-
C18-HS cartridge. HPLC analyses were performed on Agilent
Technologies 1100 instrument with G1365B UVeVIS detector,
G1316A thermostat and G1313A autosampler using Agilent Eclipse
to 10% A in 15 min, then 5 min 10% A; flow rate 1.0 mL/min; in-
jection volume: 10 mL; Method C: Agilent 5m C18 column; mobile
phase: 20 mM phosphate buffer (pH 7.0) (A) and methanol (B);
gradient: 70% A to 30% A in 15 min, then 5 min 30% A; flow rate
1.0 mL/min; injection volume: 10 mL. All tested compounds were
ꢃ95% pure by HPLC. 1H NMR and 13C NMR spectra were recorded at
400 MHz and 101 MHz, respectively, on a Bruker AVANCE III
spectrometer in DMSO-d6, CD3OD or CDCl3 solution with TMS as an
internal standard at 25 ꢁC. Spectra were assigned using gradient
COSY, HSQC and DEPT experiments. IR spectra were recorded on a
Thermo Nicolet Nexus 470 ESP FT-IR spectrometer. Mass spectra
Plus C18 column (5
mm, 4.6 ꢂ 150 mm). Three different methods
were used for HPLC analyses: Method A: Agilent 5
m
C18 column;
were obtained using
a
VG Analytical Autospec
Q
mass

ꢀ
Z. Hodnik et al. / European Journal of Medicinal Chemistry 103 (2015) 551e562
559
spectrometer. Microanalyses were performed on a PerkineElmer
C,H,N analyzer 2400 II. All reported yields are yields of purified
products.
4.2.3.2. (E)-((Hex-3-ene-3,4-diylbis(4,1-phenylene))bis(oxy))bis(bu-
tane-4,1-diyl) diacetate (5). Yield: 213 mg (86%); white solid; IR
(ATR)
n
2982, 2953, 2929, 2869, 1732, 1608, 1531, 1472, 1364, 1241,
1178, 1060, 1034, 949, 841, 810 cmꢀ1
;
1H NMR (400 MHz, CDCl3)
d
0.79 (t, 6H, J ¼ 7.4 Hz, 2 ꢂ CH3), 1.83e1.95 (m, 8H, 4 ꢂ CH2), 2.08 (s,
4.2. Synthesis
6H, 2 ꢂ CH3), 2.15 (q, 4H, J ¼ 7.4 Hz, 2 ꢂ CH2), 4.04 (t, 4H, J ¼ 6.0 Hz,
2 ꢂ CH2), 4.18 (t, 4H, J ¼ 6.0 Hz, 2 ꢂ CH2), 6.88e6.93 (m, 4H,
4 ꢂ AreH), 7.11e7.15 (m, 4H, 4 ꢂ AreH) ppm; 13C NMR (101 MHz,
4.2.1. (E)-4,40-(Hex-3-ene-3,4-diyl)bis(methoxybenzene) (1).
Synthesized as previously described [48] Colorless oil; IR (ATR)
2960, 2931, 2870, 2834, 1606, 1506, 1463, 1286, 1240, 1174, 1034,
823 cmꢀ1 1H NMR (400 MHz, DMSO-d6)
n
CDCl3)
d 13.43 (2C), 21.03 (2C), 25.45 (2C), 25.98 (2C), 28.59 (2C),
64.21 (2C), 67.16 (2C), 113.89 (4C), 129.74 (4C), 135.06 (2C), 138.72
(2C), 157.32 (2C), 171.26 (2C) ppm. HRMS m/z for C30H40O6
([M þ Hþ]þ): calcd 497.2903; 497.2895 found. Elemental analysis
calculated (%) for C30H40O6: C 72.55, H 8.12. Found: C: 72.28, H 8.28.
;
d
0.87 (t, 6H, J ¼ 7.4 Hz,
2 ꢂ CH3), 2.48 (q, 4H, J ¼ 7.4 Hz, 2 ꢂ CH2, signal overlapped with
DMSO-d5), 3.65 (s, 6H, 2 ꢂ CH3), 6.64e6.68 (m, 4H, 4 ꢂ AreH),
6.84e6.88 (m, 4H, 4 ꢂ AreH) ppm; 13C NMR (101 MHz, DMSO-d6)
d13.19 (2C), 26.91 (2C), 54.72 (2C), 112.93 (4C), 130.45 (4C), 134.89
4.2.4. (E)-((Hex-3-ene-3,4-diylbis(4,1-phenylene))bis(oxy))
bis(propane-3,1-diyl) diacetate (4)
(2C), 137.52 (2C), 156.87 (2C) ppm. HRMS m/z for C20H24O2
([M þ Hþ]þ): calcd 297.1855; found 297.1858. Elemental analysis
calculated (%) for C20H24O2: C 81.04, H 8.16. Found: C: 80.85, H 8.11.
(E)-4,40-(Hex-3-ene-3,4-diyl)diphenol (2) (188 mg, 0.7 mmol)
was dissolved in DMF (15 mL) and cooled to 0 ꢁC. 95% sodium hy-
dride (32 mg, 1.4 mmol) was added and the solution was stirred for
30 min at room temperature. Reaction mixture was cooled to 0 ꢁC
4.2.2. (E)-4,40-(Hex-3-ene-3,4-diyl)diphenol (2)
The solution of (E)-4,40-(hex-3-ene-3,4-diyl)bis(methox-
ybenzene) (1) (6.42 g, 22.0 mmol) in dry CH2Cl2 (150 mL) was
cooled to ꢀ78 ꢁC and then BBr3 (6.36 mL, 66.0 mmol) was added
dropwise under argon atmosphere. The mixture was then stirred
for 2 h at room temperature and poured into the mixture of ice/H2O
(350 mL). The mixture was stirred for 30 min and extracted with
CH2Cl2 (2 ꢂ 200 mL). Combined organic phases were washed with
brine (1 ꢂ 300 mL), dried over Na2SO4 and concentrated under
reduced pressure. The crude product was then purified by column
chromatography with ethyl acetate/hexane as an eluent to afford
again and 3-chloropropyl acetate (180 mL, 1.47 mmol) was added.
The mixture was stirred for 18 h at 60 ꢁC, concentrated in vacuo and
suspended in ethyl acetate (50 mL). Suspension was washed with
water (1 ꢂ 40 mL),10% citric acid (1 ꢂ 40 mL) and brine (1 ꢂ 40 mL).
Organic phase was dried over Na2SO4 and the solvent was removed
under reduced pressure. The crude product was then purified by
column chromatography with dichloromethane/methanol (40:1)
as an eluent to afford 4 as white solid. Yield: 200 mg (61%); IR (ATR)
n
2950, 2929, 2869, 1739, 1607, 1510, 1467, 1367, 1230, 1175, 1046,
960, 821 cmꢀ1; 1H NMR (400 MHz, CDCl3)
d
0.79 (t, 6H, J ¼ 7.4 Hz,
compound 2 as an off-white solid. Yield: 3.66 g (63%); IR (ATR)
3405, 2975, 2931,1608,1589,1509,1426,1335,1245,1199,1171, 829,
805 cmꢀ1 1H NMR (400 MHz, DMSO-d6)
n
2 ꢂ CH3), 2.10 (s, 6H, 2 ꢂ CH3), 2.11e2.18 (m, 8H, 4 ꢂ CH2), 4.10 (t,
4H, J ¼ 6.2 Hz, 2 ꢂ CH2), 4.31 (t, 4H, J ¼ 6.2 Hz, 2 ꢂ CH2), 6.89e6.94
(m, 4H, 4 ꢂ AreH), 7.11e7.16 (m, 4H, 4 ꢂ AreH) ppm; 13C NMR
;
d
0.71 (t, 6H, J ¼ 7.4 Hz,
2 ꢂ CH3), 2.07 (q, 4H, J ¼ 7.4 Hz, 2 ꢂ CH2), 6.74e6.79 (m, 4H,
(101 MHz, CDCl3)
d 13.43 (2C), 21.02 (2C), 28.60 (2C), 28.71 (2C),
4 ꢂ AreH), 6.96e7.01 (m, 4H, 4 ꢂ AreH), 9.33 (s, 2H, 2 ꢂ OH) ppm;
61.41 (2C), 64.19 (2C), 113.92 (4C), 129.75 (4C), 135.18 (2C), 138.72
13C NMR (101 MHz, DMSO-d6)
d 13.32 (2C), 28.03 (2C), 114.85 (4C),
(2C), 157.18 (2C), 171.14 (2C) ppm. HRMS m/z for
C28H36O6
129.30 (4C), 132.48 (2C), 137.93 (2C), 155.68 (2C) ppm. HRMS m/z
for C18H20O2 ([M þ Hþ]þ): calcd 269.1542; found 269.1545. HPLC:
Method B, retention time: 14.93 min (99.9% at 254 nm).
([M þ Hþ]þ): calcd 469.2590; found 469.2579. Elemental analysis
calculated (%) for C28H36O6: C 71.77, H 7.74. Found: C: 71.56, H 7.81.
4.2.5. Synthesis of compounds 6e8
4.2.3. Synthesis of compounds 3 and 5
Compound 3, 4 or 5 (0.35 mmol) was dissolved in methanol
(20 mL) and cooled to 0 ꢁC. 1 M NaOH(aq) (3.5 mL, 3.5 mmol) was
added dropwise and the mixture was stirred for 2 h at room tem-
perature. Reaction mixture was concentrated in vacuo, dissolved in
ethyl acetate (50 mL) and washed with 10% citric acid 2 ꢂ 40 mL)
and brine (1 ꢂ 50 mL). Organic phase was dried over Na2SO4 and
concentrated under reduced pressure to yield compound 6, 7 or 8.
To the solution of (E)-4,40-(hex-3-ene-3,4-diyl)diphenol (2)
(134 mg, 0.5 mmol) in acetone (20 mL) were added cesium car-
bonate (489 mg, 1.5 mmol) and 2-bromoethyl acetate (116
1.05 mmol) or 4-bromobutyl acetate (152 L, 1.05 mmol). The
mL,
m
mixture was stirred at 60 ꢁC for 48 h, concentrated in vacuo and
dissolved in ethyl acetate (50 mL). Solution was washed with 10%
citric acid (2 ꢂ 50 mL) and brine (1 ꢂ 50 mL). Organic phase was
dried over Na2SO4 and concentrated under reduced pressure. Crude
product was then purified by column chromatography with
dichloromethane/methanol (40:1) as an eluent to afford compound
3 or 5.
4.2.5.1. (E)-2,20-((Hex-3-ene-3,4-diylbis(4,1-phenylene))bis(oxy))
diethanol (6). Prepared from (E)-((hex-3-ene-3,4-diylbis(4,1-
phenylene))bis(oxy))bis(ethane-2,1-diyl) diacetate (3) (154 mg,
0.35 mmol) according to general procedure. Yield: 110 mg (88%);
white solid; IR (ATR)
n 3471, 2964, 1608, 1509, 1454, 1218, 1072,
4.2.3.1. (E)-((Hex-3-ene-3,4-diylbis(4,1-phenylene))bis(oxy))bis(-
ethane-2,1-diyl) diacetate (3). Yield: 183 mg (83%); white solid; IR
1027, 933 cmꢀ1; 1H NMR (400 MHz, CDCl3)
d
0.79 (t, 6H, J ¼ 7.4 Hz,
2 ꢂ CH3), 2.15 (q, 4H, J ¼ 7.4 Hz, 2 ꢂ CH2), 3.99e4.03 (m, 4H,
2 ꢂ CH2), 4.12e4.16 (m, 4H, 2 ꢂ CH2), 6.92e6.97 (m, 4H, 4 ꢂ AreH),
7.12e7.17 (m, 4H, 4 ꢂ AreH) ppm; 13C NMR (101 MHz, CDCl3)
(ATR)
n
2958, 2929, 2869, 1736, 1607, 1508, 1466, 1368, 1233, 1176,
1047, 960, 821 cmꢀ1
;
1H NMR (400 MHz, CDCl3)
d
0.78 (t, 6H,
J ¼ 7.4 Hz, 2 ꢂ CH3), 2.14 (q, 4H, J ¼ 7.4 Hz, 2 ꢂ CH2), 2.14 (s, 6H,
d 13.41 (2C), 28.59 (2C), 61.59 (2C), 69.11 (2C), 114.05 (4C), 129.82
2 ꢂ CH3), 4.20e4.25 (m, 4H, 2 ꢂ CH2), 4.45e4.49 (m, 4H, 2 ꢂ CH2),
(4C), 135.49 (2C), 138.72 (2C), 157.03 (2C) ppm. HRMS m/z for
C
Method A, retention time: 26.44 min (98.3% at 254 nm).
6.92e6.97 (m, 4H, 4 ꢂ AreH), 7.12e7.17 (m, 4H, 4 ꢂ AreH) ppm; 13
C
22H28O4 ([M þ Hþ]þ): calcd 357.2066; found 357.2056. HPLC:
NMR (101 MHz, CDCl3)
d
13.39 (2C), 20.97 (2C), 28.58 (2C), 62.98
(2C), 65.86 (2C), 114.08 (4C), 129.81 (4C), 135.53 (2C), 138.71 (2C),
156.88 (2C), 171.10 (2C) ppm. HRMS m/z for C26H32O6 ([M þ Hþ]þ):
calcd 441.2277; found 441.2271. Elemental analysis calculated (%)
for C26H32O6: C 70.89, H 7.32. Found: C: 70.79, H 7.43.
4.2.5.2. (E)-3,30-((Hex-3-ene-3,4-diylbis(4,1-phenylene))bis(oxy))
bis(propan-1-ol)
(7). Prepared
from
(E)-((hex-3-ene-3,4-
diylbis(4,1-phenylene))bis(oxy))bis(propane-3,1-diyl) diacetate (4)

ꢀ
560
Z. Hodnik et al. / European Journal of Medicinal Chemistry 103 (2015) 551e562
(164 mg, 0.35 mmol) according to general procedure. Yield: 121 mg
(90%); white solid; IR (ATR) 3600, 3498, 2953, 2869, 1732, 1608,
1512, 1472, 1364, 1237, 1178, 1032, 950, 841 cmꢀ1 1H NMR
(400 MHz, DMSO-d6)
113.98 (4C), 129.42 (4C), 134.07 (2C), 137.95 (2C), 156.90 (2C) ppm.
HRMS m/z for C22H26Na2O10S2 ([M-Naþ]ꢀ): calcd 537.0865; found
537.0881. HPLC: Method C, retention time: 13.22 min (96.3% at
254 nm).
n
;
d
0.72 (t, 6H, J ¼ 7.4 Hz, 2 ꢂ CH3), 1.88 (p, 4H,
J ¼ 6.3 Hz, 2 ꢂ CH2), 2.09 (q, 4H, J ¼ 7.4 Hz, 2 ꢂ CH2), 3.55e3.61 (m,
4H, 2 ꢂ CH2), 4.05 (t, 4H, J ¼ 6.3 Hz, 2 ꢂ CH2), 4.57 (t, 2H, J ¼ 5.2 Hz,
2 ꢂ OH), 6.92e6.97 (m, 4H, 4 ꢂ AreH), 7.09e7.14 (m, 4H, 4 ꢂ AreH)
4.2.6.3. Sodium (E)-((hex-3-ene-3,4-diylbis(4,1-phenylene))bis(oxy))
bis(propane-3,1-diyl) bis(sulfate) (11). Prepared from (E)-3,30-((hex-
ppm; 13C NMR (101 MHz, DMSO-d6)
d
13.25 (2C), 28.01 (2C), 32.17
3-ene-3,4-diylbis(4,1-phenylene))bis(oxy))bis(propan-1-ol)
(96 mg, 0.25 mmol) according to general procedure. Yield: 91 mg
(62%); yellow solid; IR (ATR) 3485, 2964, 2929, 2871, 2360, 1607,
1509, 1471, 1209, 1036, 948, 833 cmꢀ1; 1H NMR (400 MHz, DMSO-
d6)
(7)
(2C), 57.29 (2C), 64.32 (2C), 113.97 (4C), 129.38 (4C), 133.88 (2C),
137.95 (2C), 157.15 (2C) ppm. HRMS m/z for C24H32O4 ([M þ Hþ]þ):
calcd 385.2379; found 385.2369. HPLC: Method B, retention time:
17.55 min (98.1% at 254 nm).
n
d
0.68e0.76 (m, 6H, 2 ꢂ CH3), 1.91 (p, 4H, J ¼ 6.4 Hz, 2 ꢂ CH2),
2.09 (q, 4H, J ¼ 7.4 Hz, 2 ꢂ CH2), 3.89 (t, 4H, J ¼ 6.4 Hz, 2 ꢂ CH2), 4.03
(t, 4H, J ¼ 6.4 Hz, 2 ꢂ CH2), 6.92e6.97 (m, 4H, 4 ꢂ AreH), 7.09e7.14
4.2.5.3. (E)-4,40-((Hex-3-ene-3,4-diylbis(4,1-phenylene))bis(oxy))
bis(butan-1-ol) (8). Prepared from (E)-((hex-3-ene-3,4-diylbis(4,1-
phenylene))bis(oxy))bis(butane-4,1-diyl) diacetate (5) (174 mg,
0.35 mmol) according to general procedure. Yield: 125 mg (87%);
(m, 4H, 4 ꢂ AreH) ppm; 13C NMR (101 MHz, DMSO-d6)
d 13.27 (2C),
28.02 (2C), 29.01 (2C), 62.48 (2C), 64.33 (2C), 113.99 (4C), 129.40
(4C), 133.99 (2C), 137.96 (2C), 157.04 (2C) ppm. HRMS m/z for
off-white solid; IR (ATR)
n
3291, 2948, 2868, 1607, 1509, 1460, 1243,
0.79 (t, 6H,
C
24H30Na2O10S2 ([M-Naþ]): calcd 565.1178; found 565.1173. HPLC:
1173, 1049, 970, 831 cmꢀ1; 1H NMR (400 MHz, CDCl3)
d
Method A, retention time: 21.24 min (99.9% at 254 nm).
J ¼ 7.4 Hz, 2 ꢂ CH3), 1.77e1.85 (m, 4H, 2 ꢂ CH2), 1.90e1.98 (m, 4H,
2 ꢂ CH2), 2.15 (q, 4H, J ¼ 7.4 Hz, 2 ꢂ CH2), 3.78 (t, 4H, J ¼ 6.2 Hz,
2 ꢂ CH2), 4.06 (t, 4H, J ¼ 6.2 Hz, 2 ꢂ CH2), 6.90e6.94 (m, 4H,
4 ꢂ AreH), 7.11e7.16 (m, 4H, 4 ꢂ AreH) ppm; 13C NMR (101 MHz,
4.2.6.4. Sodium (E)-((hex-3-ene-3,4-diylbis(4,1-phenylene))bis(oxy))
bis(butane-4,1-diyl) bis(sulfate) (12). Prepared from (E)-4,40-((hex-
3-ene-3,4-diylbis(4,1-phenylene))bis(oxy))bis(butan-1-ol)
(103 mg, 0.25 mmol) according to general procedure. Yield: 105 mg
(68%); pale brown solid; IR (ATR) 3312, 2957, 2928, 2866, 2360,
1608, 1509, 1464, 1233, 1173, 1058, 989, 827 cmꢀ1 1H NMR
(400 MHz, DMSO-d6)
(8)
CDCl3)
d 13.43 (2C), 25.95 (2C), 28.59 (2C), 29.63 (2C), 62.63 (2C),
67.69 (2C), 113.93 (4C), 129.75 (4C), 135.11 (2C), 138.71 (2C), 157.25
(2C) ppm. HRMS m/z for C26H36O4 ([M þ Hþ]þ): calcd 413.2692;
found 413.2684. HPLC: Method B, retention time: 18.40 min (99.9%
at 254 nm).
n
;
d
0.68e0.76 (m, 6H, 2 ꢂ CH3), 1.63e1.72 (m,
4H, 2 ꢂ CH2), 1.72e1.81 (m, 4H, 2 ꢂ CH2), 2.09 (q, 4H, J ¼ 7.2 Hz,
2 ꢂ CH2), 3.77 (t, 4H, J ¼ 6.4 Hz, 2 ꢂ CH2), 3.99 (t, 4H, J ¼ 6.4 Hz,
2 ꢂ CH2), 6.92e6.97 (m, 4H, 4 ꢂ AreH), 7.08e7.14 (m, 4H, 4 ꢂ AreH)
4.2.6. Synthesis of compounds 9e12
Compound 2, 6, 7 or 8 (0.25 mmol) was dissolved in anhydrous
pyridine (10 mL) under argon atmosphere and the solution was
ppm; 13C NMR (101 MHz, DMSO-d6)
d 13.27 (2C), 25.53 (2C), 25.76
(2C), 28.02 (2C), 65.14 (2C), 66.97 (2C), 113.99 (4C), 129.38 (4C),
cooled to ꢀ16 ꢁC. Chlorosulfonic acid (330
mL, 5.0 mmol) was added
133.91 (2C), 137.96 (2C), 157.12 (2C) ppm. HRMS m/z for
dropwise and the yellow suspension was stirred at room temper-
ature for 24 h. The suspension was cooled to 0 ꢁC and the pH was
adjusted to 10 with 5 M NaOH(aq). Reaction mixture was then
stirred for 24 h at room temperature and concentrated under
reduced pressure. The solid residue was washed with the mixture
of methanol and ethanol (1:1) (4 ꢂ 30 mL) and the combined
organic phases were concentrated in vacuo. The crude product was
purified by reversed-phase column chromatography with meth-
anol/water as an eluent to afford compounds 9e12.
C
26H34Na2O10S2 ([M-Naþ]ꢀ): calcd 593.1491; found 593.1498.
HPLC: Method C, retention time: 17.25 min (99.9% at 254 nm).
4.3. Transactivation assay
HepG2 cells were seeded in 24-wells plates at density of
5 ꢂ 104 cells/well in Minimum Essential Medium with Earl's salts
containing 10% fetal bovine serum (FBS), 1% L-glutamine and 1%
penicillin/streptomycin. The transfection experiments were per-
formed using Fugene HD (Promega, Milan, Italy) according to
manufacturer specifications. For PXR mediated transactivation,
cells were transfected with 75 ng pSG5-hPXRT1, 75 ng pSG5-RXR,
250 ng of the reporter vector pGL3(henance)PXRE, and with 100 ng
of pGL4.70 (Promega), a vector encoding the Renilla gene. At 24 h
4.2.6.1. Sodium (E)-hex-3-ene-3,4-diylbis(4,1-phenylene) bis(sulfate)
(9). Prepared from (E)-4,40-(hex-3-ene-3,4-diyl)diphenol (2)
(66 mg, 0.25 mmol) according to general procedure. Yield: 81 mg
(69%); off-white solid; IR (ATR)
n 3567, 2974, 2959, 2359, 2338,
1499, 1250, 1201, 1044, 1014, 861 cmꢀ1; 1H NMR (400 MHz, DMSO-
post-transfection, cells were treated for 18 h with rifaximin (10
and compounds 1e12 (10 M), or with the combination of rifaximin
(10 M) plus compounds 1e12 (50 M). In another experimental
setting, cells were primed for 18 h with the increasing doses (10, 25
and 50 M) of rifaximin or compound 1, or with rifaximin (10 M)
in combination with increasing doses of 2 or 6 (10, 25 and 50 M).
To evaluate ER or ERR transcriptional activity, HepG2 cells were
transiently transfected with 250 ng of the reporter vector p(UAS)5X
TKLuc, 100 ng of pGL4.70-Renilla and with different vectors (150 ng
each) containing the ligand binding domain of ER or ERR cloned
upstream of the GAL4-DNA binding domain (pSG5-GAL4/ER or
pFN26-GAL4/ERR ); cells were primed for 18 h with 17 -estradiol
(10 M), genistein (10 M) and compounds 1, 2 and 6 (10 M), with
the combination of 17 -estradiol (10 M) plus compounds 1, 2 and
6 (50 M) or with the combination of genistein (10 M) plus
compounds 1, 2 and 6 (50 M). After treatments, 20 L of cellular
mM)
d6)
d
0.74 (t, 6H, J ¼ 7.4 Hz, 2 ꢂ CH3), 2.10 (q, 4H, J ¼ 7.4 Hz, 2 ꢂ CH2),
m
7.08e7.14 (m, 4H, 4 ꢂ AreH), 7.15e7.21 (m, 4H, 4 ꢂ AreH) ppm; 13
C
m
m
NMR (101 MHz, DMSO-d6)
d 13.23 (2C), 28.03 (2C), 120.06 (4C),
128.70 (4C),136.49 (2C),138.08 (2C),151.92 (2C) ppm. HRMS m/z for
m
m
C
18H18Na2O8S2 ([M-Naþ]ꢀ): calcd 449.0341; found 449.0333. HPLC:
m
Method A, retention time: 15.69 min (95.7% at 254 nm).
a
b
-
4.2.6.2. Sodium (E)-((hex-3-ene-3,4-diylbis(4,1-phenylene))bis(oxy))
bis(ethane-2,1-diyl) bis(sulfate) (10). Prepared from (E)-2,20-((hex-
3-ene-3,4-diylbis(4,1-phenylene))bis(oxy))diethanol (6) (89 mg,
0.25 mmol) according to general procedure. Yield: 99 mg (71%);
a
b
a
b
b
yellow solid; IR (ATR)
1443, 1236, 1177, 1070, 917, 837 cmꢀ1
d6)
n
3538, 2953, 2929, 2869, 2359, 1606, 1508,
m
m
m
;
1H NMR (400 MHz, DMSO-
b
m
d
0.69e0.76 (m, 6H, 2 ꢂ CH3), 2.05e2.13 (m, 4H, 2 ꢂ CH2),
m
m
4.01e4.07 (m, 4H, 2 ꢂ CH2), 4.11e4.17 (m, 4H, 2 ꢂ CH2), 6.93e6.99
m
m
(m, 4H, 4 ꢂ AreH), 7.10e7.15 (m, 4H, 4 ꢂ AreH) ppm; 13C NMR
lysate were assayed for luciferase activity using the Luciferase Assay
System (Promega). Luminescence was measured using GloMax™
(101 MHz, DMSO-d6)
d
13.27 (2C), 28.01 (2C), 64.24 (2C), 66.56 (2C),

ꢀ
Z. Hodnik et al. / European Journal of Medicinal Chemistry 103 (2015) 551e562
561
20/20 Luminometer (Promega). Luciferase activities were normal-
ized for transfection efficiencies by dividing the Luciferase relative
light units (RLU) by Renilla relative lights units (RRU), expressed
from cells co-transfected with pGL4.70-Renilla.
until the gradient value was smaller than 0.001 kcal/(mol Å). The
optimized structure was further refined with GAMESS interface in
ChemBio3D Ultra 13.0 using semiempirical PM3 method, QA opti-
mization algorithm and Gasteiger Hückel charges for all atoms for
100 steps [59]. Molecular docking calculations were performed
using GOLD program version 5.2 [49]. Hyperforin and water mol-
ecules were deleted from the crystal structure of PXR-hyperforin
complex (PDB code: 1M13), and hydrogen atoms were added to
the protein using GOLD. The amino acid residues within a radius of
8 Å around the hyperforin were defined as the ligand-binding site.
4.4. Quantitative real-time PCR
HepG2 cells were seeded in a 6-well plate at 5 ꢂ 105 cells/well in
Minimum Essential Medium, with Earl's salts containing 10% fetal
bovine serum (FBS), 1%
After growing to approximately 70% confluence, cells were serum
starved for 24 h and then primed with rifaximin (10 M) or com-
pound 1, or with the combination of rifaximin (10 M) plus com-
pound 2 or 6 (25 M) for 18 h. Total RNA was isolated with TRIzol
L-glutamine and 1% penicillin/streptomycin.
m
4.6.2.2. Ligand docking. Compounds 1e12 were docked in 25 in-
dependent GA runs. The GA parameters were set as suggested by
GOLD 5.2. CHEMPLP [50] was used as scoring function. Ten best
ranked docking solutions were inspected visually and the best
ranked GOLD-calculated conformation was used for analysis and
representation. The figures were prepared by PyMOL [51].
m
m
Reagent (Invitrogen), incubated with DNase I (Invitrogen) and
random reverse-transcribed with Superscript II (Invitrogen) ac-
cording to manufacturer specifications. For quantitative RT-PCR,
10 ng of template was dissolved in a 20
mL solution containing
200 nM of each primer and 10 L of KAPA SYBR FAST Universal
m
Acknowledgments
qPCR Kit (KAPA BIOSYSTEMS). All reactions were performed in
triplicate on iCycler instrument (Biorad); the thermal cycling con-
ditions were as follows: 3 min at 95 ꢁC, followed by 40 cycles of
This work was supported by the European Union FP7 Integrated
Project MAREX: Exploring Marine Resources for Bioactive Com-
pounds: From Discovery to Sustainable Production and Industrial
Applications (Project No. FP7-KBBE-2009-3-245137) and Slovenian
Research Agency (Programme P1-0208). We thank OpenEye Sci-
entific Software, Santa Fe, NM., for free academic licenses for the
use of their software.
95 ꢁC for 15 s, 58 ꢁC for 20 s and 72 ꢁC for 30 s. The relative mRNA
DDCt)
expression was calculated and expressed as 2-(
.
PCR primers were designed using the software PRIMER3 (http://
frodo.wi.mit.edu/primer3/) with published sequence data obtained
from the NCBI database. Primers were as follows:
hGAPDH: GAAGGTGAAGGTCGGAGT and CATGGGTGGAATCAT
ATTGGAA;
hPXR: AGCTGGAACCATGCTGACTT and CACATACACGGCAGA
TTTG;
hCYP3a4: CAAGACCCCTTTGTGGAAAA and CGAGGCGACTTTCTT
TCATC.
Appendix A. Supplementary data
Supplementary data related to this article can be found at http://
dx.doi.org/10.1016/j.ejmech.2015.09.005.
References
4.5. Statistical analysis
[1] M. Pawlak, P. Lefebvre, B. Staels, General molecular biology and architecture of
nuclear receptors, Curr. Top. Med. Chem. 12 (2012) 486e504.
[2] J.L. Staudinger, B. Goodwin, S.A. Jones, D. Hawkins-Brown, K.I. MacKenzie,
A. Latour, Y.P. Liu, C.D. Klaassen, K.K. Brown, J. Reinhard, T.N. Willson,
B.H. Koller, S.A. Kliewer, The nuclear receptor PXR is a lithocholic acid sensor
that protects against liver toxicity, Proc. Natl. Acad. Sci. U. S. A. 98 (2001)
3369e3374.
[3] C.J. Xu, C.Y.T. Li, A.N.T. Kong, Induction of phase I, II and III drug metabolism/
transport by xenobiotics, Arch. Pharm. Res. 28 (2005) 249e268.
[4] N. Albermann, F.H. Schmitz-Winnenthal, K. Z'Graggen, C. Volk,
M.M. Hoffmann, W.E. Haefeli, J. Weiss, Expression of the drug transporters
MDR1/ABCB1, MRP1/ABCC1, MRP2/ABCC2, BCRP/ABCG2, and PXR in periph-
eral blood mononuclear cells and their relationship with the expression in
intestine and liver, Biochem. Pharmacol. 70 (2005) 949e958.
[5] Y.E. Timsit, M. Negishi, CAR and PXR: the xenobiotic-sensing receptors, Ste-
roids 72 (2007) 231e246.
[6] S. Fiorucci, E. Distrutti, G. Bifulco, M.V. D'Auria, A. Zampella, Marine sponge
steroids as nuclear receptor ligands, Trends Pharmacol. Sci. 33 (2012)
591e601.
[7] R.E. Watkins, J.M. Maglich, L.B. Moore, G.B. Wisely, S.M. Noble, P.R. Davis-
Searles, M.H. Lambert, S.A. Kliewer, M.R. Redinbo, 2.1 angstrom crystal
structure of human PXR in complex with the St. John's wort compound
hyperforin, Biochemistry 42 (2003) 1430e1438.
Computation of EC50 or IC50 values and statistics were per-
formed using Graph Pad Prism 3 software. All values are expressed
as the mean SD. Comparisons of more than 2 groups were made
with the one-way analysis of variance with post-hoc Tukey tests.
Differences were considered statistically significant if p was <0.05.
4.6. Molecular modelling
4.6.1. 3D similarity
Molecular overlays of solomonsterols B and 10, as well as of
bazedoxifene-based antagonist (I) and 2 were performed with
ROCS (OpenEyeScientific Software, Inc.) [45e47]. Prior to ROCS
calculation, conformer libraries for compounds 2 and 11, were
generated by OMEGA (OpenEye Scientific Software, Inc.) [55e57].
Solomonsterol B or bazedoxifene-based antagonist (I) was used as a
query in ROCS and the OMEGA-generated conformer library of 2 or
10 was used as a compound database, respectively. ROCS overlays
the chemical structures with the query structure and then com-
pares their shapes (shape score) and the chemical types of their
atoms (expressed as color, color score). Compound conformations
were ranked by TanimotoCombo score, which is a combination of
shape and color similarities. The highest ranked conformation was
used for representation.
[8] S. Mani, W. Dou, M.R. Redinbo, PXR antagonists and implication in drug
metabolism, Drug Metab. Rev. 45 (2013) 60e72.
[9] H.W. Wang, H.Y. Huang, H. Li, D.G. Teotico, M. Sinz, S.D. Baker, J. Staudinger,
G. Kalpana, M.R. Redinbo, S. Mani, Activated pregnenolone X-receptor is a
target for ketoconazole and its analogs, Clin. Cancer Res. 13 (2007)
2488e2495.
[10] A. Biswas, S. Mani, M.R. Redinbo, M.D. Krasowski, H. Li, S. Ekins, Elucidating
the 'Jekyll and Hyde' nature of PXR: the case for discovering antagonists or
allosteric antagonists, Pharm. Res. 26 (2009) 1807e1815.
[11] J. Cheng, Y.M. Shah, F.J. Gonzalez, Pregnane X receptor as a target for treat-
ment of inflammatory bowel disorders, Trends Pharmacol. Sci. 33 (2012)
323e330.
[12] Y.M. Shah, X. Ma, K. Morimura, I. Kim, F.J. Gonzalez, Pregnane X receptor
activation ameliorates DSS-induced inflammatory bowel disease via inhibi-
tion of NF-kappa B target gene expression, Am. J. Physiol. Gastrointest. Liver
Physiol. 292 (2007) 1114e1122.
4.6.2. Molecular docking
4.6.2.1. Ligand and protein preparation. The three-dimensional
models of compounds 1e12 were built in ChemBio3D Ultra 13.0.
The geometry of the molecules was optimized using MMFF94 [58]
force field and partial atomic charges. The energy was minimized

ꢀ
562
Z. Hodnik et al. / European Journal of Medicinal Chemistry 103 (2015) 551e562
[13] A. Mencarelli, M. Migliorati, M. Barbanti, S. Cipriani, G. Palladino, E. Distrutti,
B. Renga, S. Fiorucci, Pregnane X receptor mediates the anti-inflammatory
activities of rifaximin on detoxification pathways in intestinal epithelial
cells, Biochem. Pharmacol. 80 (2010) 1700e1707.
resistance in osteosarcoma cell lines, Cancer 109 (2007) 957e965.
[33] N. Ouyang, S. Ke, N. Eagleton, Y. Xie, G. Chen, B. Laffins, H. Yao, B. Zhou, Y. Tian,
Pregnane X receptor suppresses proliferation and tumourigenicity of colon
cancer cells, Brit. J. Cancer 102 (2010) 1753e1761.
[14] V. Sepe, R. Ummarino, M.V. D'Auria, A. Mencarelli, C. D'Amore, B. Renga,
A. Zampella, S. Fiorucci, Total synthesis and pharmacological characterization
of solomonsterol A, a potent marine pregnane X receptor agonist endowed
with anti-inflammatory activity, J. Med. Chem. 54 (2011) 4590e4599.
[15] X. Ma, Y.M. Shah, G.L. Guo, T. Wang, K.W. Krausz, J.R. Idle, F.J. Gonzalez,
Rifaximin is a gut-specific human pregnane X receptor activator, J. Pharmacol.
Exp. Ther. 322 (2007) 391e398.
[34] T.W. Synold, I. Dussault, B.M. Forman, The orphan nuclear receptor SXR
coordinately regulates drug metabolism and efflux, Nat. Med.
584e590.
7 (2001)
[35] L. Krausova, L. Stejskaova, H.W. Wang, R. Vrzal, Z. Dvorak, S. Mani, P. Pavek,
Metformin suppresses pregnane X receptor (PXR)-regulated transactivation of
CYP3A4 gene, Biochem. Pharmacol. 82 (2011) 1771e1780.
[36] S. Mani, W. Dou, M.R. Redinbo, PXR antagonists and implication in drug
metabolism, Drug Metab. Rev. 45 (2013) 60e72.
[16] C. Festa, S. De Marino, M.V. D'Auria, G. Bifulco, B. Renga, S. Fiorucci, S. Petek,
ꢀ
ꢀ ꢀ
ꢀ ꢂ
ꢀ
A. Zampella, Solomonsterols
A
and
B
from Theonella swinhoei. The first
[37] Z. Hodnik, L. Peterlin Masic, T. Tomasic, D. Smodis, C. D'Amore, S. Fiorucci,
D. Kikelj, Bazedoxifene scaffold-based mimetics of solomonsterols A and B as
novel pregnane X receptor antagonists, J. Med. Chem. 57 (2014) 4819e4833.
[38] Y. Xue, E. Chao, W.J. Zuercher, T.M. Willson, J.L. Collins, M.R. Redinbo, Crystal
structure of the PXR-T1317 complex provides a scaffold to examine the po-
tential for receptor antagonism, Bioorg. Med. Chem. 15 (2007) 2156e2166.
[39] H.W. Wang, H. Li, L.B. Moore, M.D.L. Johnson, J.M. Maglich, B. Goodwin,
O.R.R. Ittoop, B. Wisely, K. Creech, D.J. Parks, J.L. Collins, T.M. Willson,
G.V. Kalpana, M. Venkatesh, W. Xie, S.Y. Cho, J. Roboz, M. Redinbo, J.T. Moore,
S. Mani, The phytoestrogen coumestrol is a naturally occurring antagonist of
the human pregnane x receptor, Mol. Endocrinol. 22 (2008) 838e857.
[40] D.M. Tanenbaum, Y. Wang, S.P. Williams, P.B. Sigler, Crystallographic com-
parison of the estrogen and progesterone receptor's ligand binding domains,
Proc. Natl. Acad. Sci. U. S. A. 95 (1998) 5998e6003.
example of C-24 and C-23 sulfated sterols from a marine source endowed
with a PXR agonistic activity, J. Med. Chem. 54 (2011) 401e405.
[17] V. Sepe, R. Ummarino, M.V. D'Auria, B. Renga, S. Fiorucci, A. Zampella, The first
total synthesis of solomonsterol B, a marine pregnane X receptor agonist, Eur.
J. Org. Chem. 2012 (2012) 5187e5194.
[18] S. De Marino, R. Ummarino, M.V. D'Auria, M.G. Chini, G. Bifulco, C. D'Amore,
B. Renga, A. Mencarelli, S. Petek, S. Fiorucci, A. Zampella, 4-Methylenesterols
from Theonella swinhoei sponge are natural pregnane X receptor agonists
and farnesoid X receptor antagonists that modulate innate immunity, Steroids
77 (2012) 484e495.
[19] V. Sepe, C. D'Amore, R. Ummarino, B. Renga, M.V. D'Auria, E. Novellino,
A. Sinisi, O. Taglialatela-Scafati, Y. Nakao, V. Limongelli, A. Zampella,
S. Fiorucci, Insights on pregnane X receptor modulation. Natural and semi-
synthetic steroids from Theonella marine sponges, Eur. J. Med. Chem. 73
(2014) 126e134.
[20] V. Sepe, F.S. Di Leva, C. D'Amore, C. Festa, S. De Marino, B. Renga, M.V. D'Auria,
E. Novellino, V. Limongelli, L. D'Souza, M. Majik, A. Zampella, S. Fiorucci,
Marine and semi-synthetic hydroxysteroids as new scaffolds for pregnane X
receptor modulation, Mar. Drugs 12 (2014) 3091e3115.
[21] C. Festa, C. D'Amore, B. Renga, G. Lauro, S. De Marino, M.V. D'Auria, G. Bifulco,
A. Zampella, S. Fiorucci, Oxygenated polyketides from Plakinastrella mamillaris
as a new chemotype of PXR agonists, Mar. Drugs 11 (2013) 2314e2327.
[22] L. Xiao, E. Nickbarg, W. Wang, A. Thomas, M. Ziebell, W.W. Prosise,
C.A. Lesburg, S.S. Taremi, V.L. Gerlach, H.V. Le, K.C. Cheng, Evaluation of
in vitro PXR-based assays and in silico modeling approaches for under-
standing the binding of a structurally diverse set of drugs to PXR, Biochem.
Pharmacol. 81 (2011) 669e679.
[41] A.K. Shiau, D. Barstad, P.M. Loria, L. Cheng, P.J. Kushner, D.A. Agard,
G.L. Greene, The structural basis of estrogen receptor/coactivator recognition
and the antagonism of this interaction by tamoxifen, Cell 95 (1998) 923e937.
[42] O. Kuzbari, C.M. Peterson, M.R. Franklin, L.B. Hathaway, E.B. Johnstone,
A.O. Hammoud, J.G. Lamb, Comparative analysis of human CYP3A4 and rat
CYP3A1 induction and relevant gene expression by bisphenol A and dieth-
ylstilbestrol: Implications for toxicity testing paradigms, Reprod. Toxicol. 37
(2013) 24e30.
[43] B. Blumberg, W. Sabbagh, H. Juguilon, J. Bolado, C.M. van Meter, E.S. Ono,
R.M. Evans, SXR, a novel steroid and xenobiotic-sensing nuclear receptor,
Genes Dev. 12 (1998) 3195e3205.
[44] W. Mnif, J.-M. Pascussi, A. Pillon, A. Escande, A. Bartegi, J.-C. Nicolas,
V. Cavailles, M.-J. Duchesne, P. Balaguer, Estrogens and antiestrogens activate
hPXR, Toxicol. Lett. 170 (2007) 19e29.
[23] J.M. Pascussi, L. Drocourt, J.M. Fabre, P. Maurel, M.J. Vilarem, Dexamethasone
induces pregnane X receptor and retinoid X receptor-alpha expression in
human hepatocytes: synergistic increase of CYP3A4 induction by pregnane X
receptor activators, Mol. Pharmacol. 58 (2000) 361e372.
[24] S.A. Jones, L.B. Moore, J.L. Shenk, G.B. Wisely, G.A. Hamilton, D.D. McKee,
N.C.O. Tomkinson, E.L. LeCluyse, M.H. Lambert, T.M. Willson, S.A. Kliewer,
J.T. Moore, The pregnane x receptor: a promiscuous xenobiotic receptor that
has diverged during evolution, Mol. Endocrinol. 14 (2000) 27e39.
[25] R.E. Watkins, G.B. Wisely, L.B. Moore, J.L. Collins, M.H. Lambert, S.P. Williams,
T.M. Willson, S.A. Kliewer, M.R. Redinbo, The human nuclear xenobiotic re-
ceptor PXR: structural determinants of directed promiscuity, Science 292
(2001) 2329e2333.
[45] J.A. Grant, M.A. Gallardo, B.T. Pickup, A fast method of molecular shape
comparison: a simple application of a Gaussian description of molecular
shape, J. Comput. Chem. 17 (1996) 1653e1666.
[46] P.C.D. Hawkins, A.G. Skillman, A. Nicholls, Comparison of shape-matching and
docking as virtual screening tools, J. Med. Chem. 50 (2007) 74e82.
[47] ROCS 3.2.0.4: OpenEye Scientific Software, Santa Fe, NM. http://www.
eyesopen.com.
[48] J.E. McMurry, M.P. Fleming, New method for reductive coupling of carbonyls
to olefins. Synthesis of beta-carotene, J. Am. Chem. Soc. 96 (1974) 4708e4709.
[49] Gold, v5.2; The Cambridge Crystallographic Data Centre, 12 Union Road,
Cambridge, CB2 1EZ, UK, www.ccdc.cam.ac.uk.
[50] O. Korb, T. Stutzle, T.E. Exner, Empirical scoring functions for advanced
protein-ligand docking with PLANTS, J. Chem. Inf. Model 49 (2009) 84e96.
[51] PyMOL, Delano Scientific LLC, San Francisco, CA, http://pymol.sourceforge.net.
[52] G.B. Tremblay, T. Kunath, D. Bergeron, L. Lapointe, C. Champigny, J.A. Bader,
J. Rossant, V. Giguere, Diethylstilbestrol regulates trophoblast stem cell dif-
ferentiation as a ligand of orphan nuclear receptor ERR beta, Genes Dev. 15
(2001) 833e838.
[26] Y.K. Chen, D.T. Nie, Pregnane X receptor and its potential role in drug resis-
tance in cancer treatment, Recent Pat. Anticancer Drug Discov. 4 (2009)
19e27.
[27] Y. Miki, T. Suzuki, K. Kitada, N. Yabuki, R. Shibuya, T. Moriya, T. Ishida,
N. Ohuchi, B. Blumberg, H. Sasano, Expression of the steroid and xenobiotic
receptor and its possible target gene, organic anion transporting polypeptide-
A, in human breast carcinoma, Cancer Res. 66 (2006) 535e542.
[28] D. Gupta, M. Venkatesh, H.W. Wang, S. Kim, M. Sinz, G.L. Goldberg,
K. Whitney, C. Longley, S. Mani, Expanding the roles for pregnane X receptor
in cancer: proliferation and drug resistance in ovarian cancer, Clin. Cancer Res.
14 (2008) 5332e5340.
[29] H. Masuyama, H. Nakatsukasa, N. Takamoto, Y. Hiramatsu, Down-regulation of
pregnane X receptor contributes to cell growth inhibition and apoptosis by
anticancer agents in endometrial cancer cells, Mol. Pharmacol. 72 (2007)
1045e1053.
[30] Y. Chen, Y. Tang, M.T. Wang, S. Zeng, D. Nie, Human pregnane x receptor and
resistance to chemotherapy in prostate cancer, Cancer Res. 67 (2007)
10361e10367.
[31] C. Raynal, J.M. Pascussi, G. Legueline, C. Breuker, J. Kantar, B. Lallemant,
S. Poujol, C. Bonnans, D. Joubert, F. Hollande, S. Lumbroso, J.P. Brouillet,
A. Evrard, Pregnane X receptor (PXR) expression in colorectal cancer cells
restricts irinotecan chemosensitivity through enhanced SN-38 glucur-
onidation, Mol. Cancer 9 (2010) 46.
[53] S. Di Micco, B. Renga, A. Carino, M.V. D'Auria, A. Zampella, R. Riccio, S. Fiorucci,
G. Bifulco, Structural insights into estrogen related Receptor-b modulation: 4-
Methylenesterols from Theonella swinhoei sponge as the first example of
marine natural antagonists, Steroids 80 (2014) 51e63.
[54] G.M. Anstead, K.E. Carlson, J.A. Katzenellenbogen, The estradiol pharmaco-
phore: ligand structure-estrogen receptor binding affinity relationships and a
model for the receptor binding site, Steroids 62 (1997) 268e303.
[55] P.C.D. Hawkins, A.G. Skillman, G.L. Warren, B.A. Ellingson, M.T. Stahl,
Conformer generation with OMEGA: algorithm and validation using high
quality structures from the protein Databank and Cambridge structural
database, J. Chem. Inf. Model 50 (2010) 572e584.
[56] P.C.D. Hawkins, A.N. Nicholls, Conformer generation with OMEGA: learning
from the dataset and analysis of failures, J. Chem. Inf. Model 52 (2012)
2919e2936.
[57] OMEGA 2.5.1.4: OpenEye Scientific Software, Santa Fe, NM. http://www.
eyesopen.com.
[58] T.A. Halgren, Merck molecular force field .1. Basis, form, scope, parameteri-
zation, and performance of MMFF94, J. Comput. Chem. 17 (1996) 490e519.
[59] GAMESS Interface for ChemBio3D Ultra 13.0 and ChemBioOffice Ultra 13.0;
CambridgeSoft: Cambridge, MA.
[32] E.J. Mensah-Osman, D.G. Thomas, M.M. Tabb, J.M. Larios, D.R. Hughes,
T.J. Giordano, M.L. Lizyness, J.M. Rae, B. Blumberg, P.F. Hollenberg, L.H. Baker,
Expression levels and activation of a PXR variant are directly related to drug