Synthesis and pharmacological characterisation of 2,4-dicarboxy-pyrroles as selective non-competitive mGluR1 antagonists.

Article abstract of DOI:10.1016/S0968-0896(02)00424-8

Metabotropic glutamate receptors (mGluRs) are an unusual family of G-protein coupled receptor (GPCR), and are characterised by a large extracellular N-terminal domain that contains the glutamate binding site. We have identified a new class of non-competit

Full text of DOI:10.1016/S0968-0896(02)00424-8

Bioorganic & Medicinal Chemistry 11 (2003) 171–183
Synthesis and Pharmacological Characterisation of
2,4-Dicarboxy-pyrroles as Selective Non-Competitive
mGluR1 Antagonists
Fabrizio Micheli,* Romano Di Fabio,* Paolo Cavanni, Joseph M. Rimland,
Anna Maria Capelli, Cristiano Chiamulera, Mauro Corsi, Corrado Corti,
Daniele Donati, Aldo Feriani, Francesco Ferraguti,y Micaela Maffeis,
Andrea Missio, Emiliangelo Ratti, Alfredo Paio, Roberta Pachera,
Mauro Quartaroli, Angelo Reggiani,{ Fabio Maria Sabbatini,
David G. Trist, Annarosa Ugolini and Giovanni Vitulli
GlaxoSmithkline Medicine Research Centre, Via Fleming, 4-37135 Verona, Italy
Received 28 June 2002; accepted 22 August 2002
Abstract—Metabotropic glutamate receptors (mGluRs) are an unusual family of G-protein coupled receptor (GPCR), and are
characterised by a large extracellular N-terminal domain that contains the glutamate binding site. We have identified a new class of
non-competitive metabotropic glutamate receptor 1 (mGluR1) antagonists, 2,4-dicarboxy-pyrroles which are endowed with nano-
molar potency. They interact within the 7 transmembrane (7TM) domain of the receptor and show antinociceptive properties when
tested in a number of different animal models.
# 2002 Elsevier Science Ltd. All rights reserved.
Introduction
To date, the mGluRs family comprises eight subtypes
which have been cloned and named mGluR1–8 accord-
ing to the succession of the molecular cloning. The eight
receptors are divided into three groups on the basis of
sequence similarity, pharmacology and transduction
mechanisms: Group I (mGluR1 and mGluR5), Group
II (mGluR2 and mGluR3) and Group III (mGluR4,
mGluR6, mGluR7 and mGluR8). This picture is made
more complex by the expression of several splice var-
iants for some of the different subtypes.16 In the specific
case of mGluR1, there are four different splice variants
named 1a, 1b, 1c, and 1d. It is reported that mGluR1
mainly activates phospholipase C (PLC) to increase
intracellular calcium.
Glutamate, the principal excitatory neurotransmitter in
mammalian brain, is involved in many brain functions.
Its actions are mediated through ionotropic (NMDA,
AMPA and Kainate)1À5 and metabotropic receptors
(mGluRs).6,7 These latter receptors couple to G proteins
and control the activity of membrane enzymes and ion
channels.8À10 A distinctive feature of the mGluRs is the
large amino-terminal domain which contains the gluta-
mate binding site11,12 and, together with the parathyroid
calcium sensing, the g-aminobutyric (GABA)B, and the
vomeronasal receptors, form a separate family of
GPCRs showing very little homology with other cloned
receptors.13À15
The role of mGluR1 in physiological and pathological
conditions is being investigated using currently available
agonists and antagonists.17 Quisqualate,18 and (S)-3,5-
dihydroxyphenylglycine [(S)-3,5-DHPG],19 are selective
group I agonists and (S)-4-carboxy-3-hydroxyphenyl
glycine [(S)-4C3HPG],20 (S)-(+)-2-(30-carboxybicyclo
[1.1.1]pentyl)-glycine [(S)-CBPG],21 (S)-4-carboxy-phenyl
glycine [(S)->4CPG],22 2-(30-(1H-tetrazol-5-yl)bicyclo
[1.1.1]pent-1-yl)glycine (S-TBPG),23 LY-36736624 are
*Corresponding authors. Tel.:+39-045-921-8515; fax:+39-045-921-
8196 e-mail: fm20244@gsk.com (F. Micheli); Tel.:+39-045-921-8879;
fax:+39-045-921-8196 e-mail: rdf26781@gsk.com (R. Di Fabio).
yCurrent address: MRC Anatomical Neuropharmacology Unit, Uni-
versity of Oxford, Mansfield Road, Oxford, OX1 3TH UK.
{Current address: ScheringPlough, S. Raffaele Science Park, Milan,
Italy.
0968-0896/03/$ - see front matter # 2002 Elsevier Science Ltd. All rights reserved.
PII: S0968-0896(02)00424-8

172
F. Micheli et al. / Bioorg. Med. Chem. 11 (2003) 171–183
competitive antagonists. CPCCOEt [7-(hydroxyimino)-
cyclopropan[b]-chromen-1a-carboxylic acid ethylester],
the first non-competitive antagonist of mGluR1, was
identified and characterised,25 and another very potent
and non competitive derivative, BAY 36-7620, was also
recently disclosed.26 Some of these derivatives are
reported in Figure 1.
sets. Among the different groupings obtained, a set was
arranged considering (S)-4C3HPG and (S)-4CPG as
primary tools and topologically matching the ‘distance’
existing between the aminoacidic moiety of these mole-
cules and the remaining carboxylic group. This exercise
led to the selection of compounds endowed with an
averaged ‘distance’ from three to five bond lenght
betwen the two considered moiety, as schematically
depicted in Figure 2. All the derivatives fulfilling the
above reported query were ‘filtered’ using general ‘drug
like’ properties (MW<600; ClogP<5; Rotable
bonds<10; H-donors<5; H-acceptors<5) and the
approximately four thousands derivatives obtained were
screened in CHO cells expressing rat mGluR1a
(r-mGluR1a-CHO) measuring accumulation of cytidine
diphosphate-diacylglycerol (CDP-DAG).35
According to studies reported in the literature, the
mGluR1 receptor seems mainly involved in therapeutic
opportunities for the treatment of stroke/brain
injury,27,28 and pain.29,30 Evidence, though discording,
on the physiopathological role of mGluR1 are also
available from the generation of knock-out mice.31,32
Results
Further characterisation was subsequently performed
by measuring intracellular calcium [Ca2+]i.36 mobiliza-
tion using a fluorescent imaging plate reader (FLIPR).
The methods are described in the biology part of this
paper.
Synthesis
Despite intense efforts both in academia and industry,
to date only relatively few mGluR1 antagonists are
available. Moreover, these derivatives, regardless of
their relatively high selectivity, generally show poor
pharmacokinetic properties. This ‘relative lack’ of very
potent antagonists might be due either to the peculiar
characteristics of this receptor or to a lack of the
appropriate chemical diversity in corporate databases
used as a main source for High Throughput Screening
(HTS) efforts. To shed light on this problem, a theoretical
structure of the mGluR1 glutamate binding site was dee-
ply analyzed and elucidated by a number of modeling
studies by Prof. Pellicciari’s group in Perugia.33,34
Among the different hits identified, 2,4-carboxy-3,5-
dimethyl-pyrrole ethyl ester (1, Fig. 3) showed micro-
molar potency at the receptor (IC50=15.8 mM;
pIC50=4.8) at the receptor. This structure immediately
elicited our interest for a number of reasons. Firstly, it
was not an amino acid derivative. Secondly, it had no
relationship with any known structures of agonists or
antagonists. Finally, it was quite a small and simple
molecule and it represented an attractive scaffold for
chemical manipulation exploiting combinatorial metho-
dologies. However, derivative 1 could also have been a
false positive compound which, instead of acting at the
receptor, interfered at some point in the second mes-
senger cascade. This issue, together with selectivity ver-
sus other receptor subtypes, was immediately tackled
and solved for this product and other derivatives as
reported in the biology part of the paper.
As a part of our continuing efforts in the identification
of New Chemical Entities (NCE) endowed with pharma-
cological activity, and to carry out focussed screening
activities, literature data were used to bias the selection
of a number of discrete compounds belonging both to
the corporate Data Base and to commercially available
Figure 2. Schematic representation of the topological query used to
select derivatives both on the corporate and commercial databases and
based on (S)-4C3HPG and (S)-4CPG.
Figure 1. Some known agonist and antagonists at the mGluR1 receptor.
Figure 3. Some of the newly discovered mGluR1 antagonists.

F. Micheli et al. / Bioorg. Med. Chem. 11 (2003) 171–183
173
Scheme 1. Exploitation of the pyrrolic template versatility: chemical exploration around derivative 1. Reagents and conditions: (a) H2SO4; (b)
NaOH.
Considering all the ‘attractive hooks’ mentioned above
for the derivative 1 class, a limited investigation was
initially planned to understand the key pharmacophoric
features of this molecule and therefore a relatively low
number of discretes was synthesized.
dicarboxylic acid (2, Fig. 3) with a 100-fold increase in
potency compared to the parent compound 1 (158 nM,
pIC50=6.8). Derivative 2 was further tested to validate
its activity on the mGluR1 receptor. It is worth noting
that not only did the analogue behave as a non-compe-
titive mGluR1 antagonist like 1 but it was also selective
(>100-fold) versus rat-mGluR2, -4 and -5 (no activity
shown up to 500 mM). Considering these extremely
promising results, a combinatorial exploration of the
C-2 and C-4 positions of the pyrrolic scaffold was
appropriately designed to optimize the receptor potency
of the compounds. According to the synthetic pathway
shown in Scheme 2, commercially available primary and
secondary alcohols were computationally selected and
the chemically interfering groups (e.g., free carboxylic
acids, un-protected amines, phenols, etc.) were removed.
Two different sets were prepared: one to be reacted with
position C-4 (R5-OH) and one for modification of posi-
tion C-2 (R6OH). In order to produce a library endowed
with general ‘drug like’ properties, both monomer sets
underwent molecular weight and lipophilicity cut-offs:
the R5OH alcohols were chosen with a Mr <250, while
the R6OH monomers were selected among those with a
Mr <200. Moreover, all the monomers selected had a
ClogP <2 unless they were bearing heteroatoms such as
N, O, S, Cl, Br, in which case the threshold used was
ClogP <3.5. The remaining molecules were clustered
according to a non-hierarchical Jarvis–Patrick method.
The centroid of each cluster was then chosen and a virtual
library generated. At the end of the filtration process, the
The chemical versatility of derivative 1 was known since
the end of the XIXth century37À39 and was exploited as
depicted in Scheme 1.
Acid hydrolysis selectively affected position C-4, while
basic saponification modified only position C-2. The
coupling of the selectively obtained C-2 or C-4 free acid
with appropriate alcohols or amines led to a preliminary
structure–activity relationship (SAR).
We noticed that the removal of the esteric moiety led to
a complete loss of activity at the receptor: neither the
monoacid derivatives in position C-4 (4, Scheme 1) nor
its C-2 regioisomer (5, Scheme 1) showed measurable
interaction with the receptor. Furthermore, the com-
pletely deprotected product (6, Scheme 1) was also
inactive. In contrast, the increase in the bulkyness/lipo-
philicity of the C-4 esteric moiety led to a significant
increase in potency. As depicted in Table 1, the C-2
position needed to be substituted too, but it was less
stringent in terms of pharmacophoric features.
The first phase of our analysis stopped with the identi-
fication of 2-propoxy-4-t-butoxy-3,5-dimethyl-pyrrole

174
F. Micheli et al. / Bioorg. Med. Chem. 11 (2003) 171–183
Table 1. Potency values of the pyrrolic derivatives on r-mGluR1a-
CHO cells using the CDP-DAG accumulation method35
R5OH sets were formed by 80 monomers, while the
R6OH group was reduced to only 20 derivatives.
Obviously, such a library (1600 derivatives) could not be
produced with the synthetic methodology shown in
Scheme 1 because of the possible problems related to
both acid and basic hydrolysis of the esteric moieties.
The new methodology described in Scheme 2 was
designed in order to use the easily obtainable and bio-
logically inactive intermediate 14 (and therefore over-
coming the possible problem of any residue of 14 left in
the plates which underwent the biological test), exploit-
ing a deprotection method which would not interfere
with the subsequent esterification reaction.
Entry
R’
R’
IC50 (mM)
1
2
Et
n-Pr
Et
t-Bu
15.8
0.16
3
n-Pr
0.0158 (15.8 nM)
The resulting library was screened on r-mGluR1a-
CHO cells by measuring mobilization [Ca2+]i with a
FLIPR. Among the positives, the most interesting
compound was a close analogue of derivative 2 in
which the t-butyl ester in position C-4 was replaced by
the racemic 3,3-dimethyl-2-butanol (pinacolyl alcohol).
This derivative (3, Fig. 1) showed a very good potency
at the receptor (15.8 nM, pIC50=7.8) maintaining the
non-competitive inhibition and showing high selectiv-
ity (>1000-fold) versus rat-mGluR2, -4 and -5. This
derivative was further characterised in a number of in
vitro and in vivo experiments described later. Given
the chiral nature of the pinacolyl ester on derivative 3,
the two enantiomers were separated by HPLC on a
chiral stationary phase and further characterised. The
(S) enantiomer 15 showed the same activity as the
racemic mixture, while the (R) enantiomer 16 was
slightly less potent as reported in Table 1. The cor-
rect assignment of the stereogenic center chirality was
performed by synthesizing each of the two pure
pinacolyl alcohols according to known methodology40
and coupling them with retention of configuration to
the corresponding carboxylic acid as depicted in
Scheme 3.
4
5
6
7
8
9
10
Et
H
H
Bn
Allyl
Bn
Bn
H
Et
H
t-Bu
t-Bu
Allyl
Bn
N.A.
N.A.
N.A.
1.9
0.39
N.A.
N.A.
11
t-Bu
0.2
12
13
n-Octyl
Ph
t-Bu
t-Bu
6.3
3.0
14
15
H
N.A.
n-Pr
n-Pr
0.0158a(15.8 nM)
16
17
0.040b (40 nM)
0.040 (40nM)
n-Pr
18
19
n-Pr
t-Bu
0.26
0.050 (50 nM)
The affinity values obtained for the synthesized discretes,
considering that their enantiomeric excess was greater
than 80%, almost perfectly matched the data obtained
on the products after separation using chromatography
on chiral stationary phase.
IC50s were measured from at least six-point inhibition curves and they
are the geometric means of at least three independent experiments.
The standard error of the mean was less than 0.05.
aPurified on chiral stationary phase.
bN.A., not active up to 100 uM.
Scheme 2. Combinatorial exploration of the pyrrolic scaffold. Reagents and conditions: (a) (CF3CO)2O, toluene, rt; (b) R5OH (80 monomers),
toluene; (c) TBAF, THF; (d) R6OH (20 monomers), toluene.

F. Micheli et al. / Bioorg. Med. Chem. 11 (2003) 171–183
175
Scheme 3. Synthesis of the pure enantiomers of derivative 3. Reagents and conditions: (a) (CF3CO)2O, toluene, rt; (b) R5OH (80 monomers), tol-
uene; (c) TBAF, THF; (d) R6OH (80 monomers), toluene.
Biology
receptor, presumably coupled to the same second mes-
senger pathway, that is CHO cells expressing the
neurokinin 3 (NK-3) receptor.41 None of the com-
pounds reported in Table 1 was able to alter the CRC of
the agonist NKB (50 nM) when tested at doses 100
times greater than their IC50 on the mGluR1 receptor.
(S)-(+)-a-Methyl-4-carboxy phenyl glycine (MCPG),42
a competitive mGluR1 antagonist, showed the same
behaviour. To further validate our discovery, the pyr-
roles were tested by measuring second messenger sig-
naling exploiting assays different from the ones
Investigations of the mechanism of action of the pyrrolic
class. To determine the behaviour and the site of action
of our newly discovered class of mGluR1 antagonists, a
number of pharmacological experiments were per-
formed beyond the more classical ones (e.g., Schield
analysis). First of all a rightward shift and depression of
the glutamate concentration–response curve (CRC) was
observed in the presence of increasing concentrations of
the antagonists. This characteristic was observed for all
the compounds of the pyrrolic class. In order to better
understand the non-competitive behavior of these
antagonists, a combined dose-ratio experiment was
designed. The known competitive antagonist MCPG42
(1 mM) and derivative 3 (10 mM) were tested separately
and then co-incubated in the presence of the agonist
glutamate (using a full glutamate CRC). The effect on
CDP-DAG accumulation was measured. The combina-
tion of the two antagonists produced a rightward shift
of the glutamate CRC suggesting a multiplicative effect
(independent effects on two different sites of action)
rather than an additive effect (action at the same site).
Comparable results were obtained with two other
mGluR1 agonists, (1S, 3R)ACPD [(1S, 3R)-1-amino-
1,3-cyclopentanedicarboxylic acid] and quisqualate.
previously used (CDP-DAG accumulation or [Ca2+
]
i
mobilisation). After pre-incubation with [3H]arachi-
donic acid ([3H]AA) and stimulation with a mGluR1
agonist, it was possible to observe an increased release
of [3H]AA in CHO cells expressing mGluR1a [this
response should be mediated by activation of phospho-
lipase A2 (PLA2) through a G-protein different from the
G-protein responsible for receptor coupling to PLC].
Also in these studies, the pyrrolic derivatives gave a
non-competitive inhibition of the agonist response,
confirming that this behaviour was independent of the
assay and coupling of the receptor, but is a character-
istic of the ligand–mGluR1 receptor interaction.
Finally, a number of experiments were performed on
cultured rat cerebellar granule cells43,44 in order to
replicate the type of antagonism observed with the
recombinant mGluR1a receptor expressed in CHO cells.
Cerebellar granule cells express mGluR1 and other Gq-
linked receptors, specifically muscarinic acetylcholine
receptors. In this neuronal cell culture model, using the
CDP-DAG assay, the non-competitive effect of the
pyrrole derivatives was confirmed against the effect of
several mGluR agonists such as quisqualate, (1S,
3R)ACPD and DHPG. No antagonism at the muscari-
nic receptor agonist carbachol was observed on the
same preparations. On the basis of the results obtained
in the previous experiments, we could therefore confirm
the identification a new class of antagonist acting on a
site of mGluR1 different from its agonist binding site.
For this reason, a series of chimeric receptors contain-
ing parts of mGluR1 and mGluR2 receptors was cre-
ated. The first chimera (Fig. 4) was composed of the
extracellular glutamate binding domain, the first TM
The reversibility of the interaction between pyrrole
derivatives and mGluR1 was tested by performing
wash-out experiments. Compounds at concentrations
100 times their IC50s, were pre-incubated for 30 min on
r-mGluR1a-CHO cells and then extensively washed
with buffer. After this treatment, a glutamate CRC was
applied. The EC50 value for glutamate on pre-treated
cells was comparable to that obtained in the control
experiments (buffer only) and after pre-treatment with
the competitive antagonist MCPG. According to the
pharmacological characterisation the pyrrole class dis-
played non-competitive antagonism of agonist activa-
tion of mGluR1. We also wanted to exclude the
possibility that derivative 3 interfered somewhere along
the second messenger cascade. In order to eliminate a
non-specific effect on the phosphoinositide pathway,
pyrrole derivatives were tested on a different Gq-coupled

176
F. Micheli et al. / Bioorg. Med. Chem. 11 (2003) 171–183
domain and the first intracellular loop of mGluR1
attached to the downstream portions of mGluR2. The
second chimera had the second and third intracellular
loops and carboxy terminal tail of mGluR1 substituted
by the corresponding regions of mGluR2 (Fig. 4).
The effect of compound 3 was first tested on wild type
human mGluR1a and human mGluR2 expressed in
Xenopus laevis oocytes. 3 mM 3 significantly (P<0.01)
reduced the current amplitude induced by 100 mM glu-
tamate from 751+124 nA to 295+48 nA in oocytes
injected with mGluR1a RNA (Fig. 5).
In contrast, the same concentration of derivative 3 did
not have any significant effect on the current of
mGluR2 activated by 100 mM glutamate. Thus only
mGluR1a is sensitive to the compound 3. We next
examined the effect of the antagonist on the two chi-
meric receptors. 3 mM 3 did not inhibit the current
induced by 100 mM glutamate in oocytes expressing
Figure 4. Schematic drawings of the chimeric receptors utilized in this
study. Chimera 1 is composed of the extracellular glutamate binding
domain, the first TM domain and the first intracellular loop of
mGluR1 attached to the downstream portion of mGluR2. Chimera 2
has the second and third intracellular loops and carboxy terminal tail
of mGluR1 substituted by the corresponding regions of mGluR2.
Figure 5. (A) Selective inhibition of mGluR1a by derivative 3. Oocytes were either injected with in vitro synthesized RNA coding for mGluR1a
alone, with RNAs encoding chimera 1 and Kir3.1 and Kir 3.4, two subunits of a G protein-coupled inwardly-rectifying potassium channel or with
RNAs coding for mR1a induced chloride currents, while they were held at À80 mV in 96 mM potassium to record mGluR2 stimulated potassium
currents. Unshaded bars (Glu)- application of 100 mM glutamate. Shaded bars (Glu+3) —oocytes were preincubated with 3 mM 3 for 20 min before
applying 100 mM glutamate with 3 mM 9. Data represent the mean+sem of the following number of oocytes shown in parentheses. mGluR1a: Glu
(n=6), Glu+3 (n=6); Chimera 1: Glu (n=3), Glu+3 (n=4); mGluR2: Glu (n=5), Glu+3 (n=3). *, P<0.01 versus Glu, Student’s t-test.). (B)
MCPG inhibits chimeric receptor 1. Oocytes were coinjected with in vitro synthesized RNAs coding for chimera 1, Kir3.1 and Kir 3.4. Voltage
clamp conditions were the same as in (B). Unshaded bars (Glu)—application of 1 mM glutamate. Shaded bars (Glu+MCPG)- oocytes were pre-
incubated for 10 min with 100 mM MCPG before applying 1 mM glutamate with 100 mM of the antagonist. Data represent the meanÆSEM of the
following number of oocytes shown in parentheses. Glu (n=5); Glu+MCPG (n=5). *, P<0.01 versus Glu, Student’s t-test. C. Chimeric receptor 2
is blocked by derivative 3. Oocytes were coinjected with in vitro synthesized RNAs coding for chimera 2, Kir3.1 and Kir 3.4. Voltage clamp con-
ditions were the same as in (B). Unshaded bars (Glu)—application of 100 mM glutamate. Shaded bars (Glu+3)- oocytes were preincubated for 20
min with 3 mM 3 before applying 100 mM glutamate with 3 mM of the antagonist. Data represent the mean+sem of the following number of oocytes
shown in parentheses. Glu (n=9); Glu+3 (n=8). **, P<0.001 versus Glu, Student’s t-test.

F. Micheli et al. / Bioorg. Med. Chem. 11 (2003) 171–183
177
chimera 1 (Fig. 5). On the other hand, the competitive
antagonist, MCPG, at 100 mM, significantly (P<0.01)
decreased the current amplitude stimulated by 1 mM
glutamate from 307Æ43 to 133Æ23 nA. In contrast to
chimera 1, the stimulation of chimera 2 by 100 mM glu-
tamate was sensitive to inhibition by compound 3 (Fig.
5). The agonist-induced current amplitude decreased
from 278+25 nA to 77Æ13 nA after application of 3
mM 3 (P<0.001). These results demonstrate that the
TM domains and extracellular loops of mGluR1 are
required for antagonism by derivative 3, thus confirm-
ing that the noncompetitive behaviour of the pyrroles is
due to a direct interaction with the receptor.
Figure 7. Wind up model. The red trace (compound 3, 1 mM) clearly
showed the ability of the pyrrolic derivative 3 to reduce the effect
generated by the multiple stimulus on the C-fibre (black trace), an
index of central sensitization.
Behavioural studies.45 Considering the possible involve-
ment of mGluR1 in nociceptive transmission, derivative
3 was characterized in well known animal models of
pain. It was active, after oral administration, both in the
early and the late phase of the formalin test46,47 in mice
(a model of both acute and inflammatory pain in the
two phases respectively) with an approximately equal
ED50 of 0.3 mg/kg. The same product showed activity in
the carrageenan test48,49 in rats (a model of inflamma-
tory pain) when administered intraperitoneally with an
ED50 of about 3 mg/kg. Finally, in the chronic con-
striction injury model (CCI)50,51 in rats (a model of
neurophatic pain), intraperitoneal administration of
compound 3, made the treated animals (blue-dotted
line, Fig. 6) behave similarly to control animals (zero
line) with respect to the non treated ones (red line, Fig.
6) with a relatively good duration of action (4 h).
which is considered to reflect the cumulative depolar-
ization of membrane potential of ventral horn neurons.
This is a complex phenomenon and is named ‘wind up’.
It may be used as an index of central sensitization
within the spinal cord. One-hour perfusion of BRSC
with 1 mM 3 reduced both the amplitude of the ventral
root potential (VRP) and the cumulative VRP as depic-
ted in Figure 7, confirming that mGluR1 antagonists can
be useful in blocking the central sensitisation process.
Discussion and Conclusions
Electrophysiological studies in vitro. The properties of
derivative 3 were also tested in an in vitro functional
model of the nociceptive pathway using an isolated
preparation of baby rat spinal cord (BRSC).52 This was
used to assess the activity on spinal C fibres, which carry
pain transmission. A single shock applied to the dorsal
roots of intensity sufficient to recruit both A- and
C-fibres was used as stimulus. The early component of
the ventral root potential (VRP) is a short-duration
A-fibre evoked wave, resistant to NMDA receptor
antagonists, but sensitive to non-NMDA receptor
antagonists. If repeated stimulations at low frequency of
C-fibre afferents are used, a summated VRP is evoked,
The 2,4-dicarboxy-pyrrole esters represent a new class
of selective non-competitive mGluR1 antagonist. The
very strict geometric and structural features required for
competitive antagonism of mGluR1 described by Pel-
licciari29,30 were clearly not fulfilled by our template.
Since the initial identification of derivative 1, a detailed
study was designed to fully exploit the remarkable pos-
sibilities of this template. The complete inactivity of acid
derivatives 4–6 immediately implied that we were prob-
ably facing something different from the known com-
petitive antagonists. It was therefore necessary to
explore the new pyrrolic scaffold to determine the
pharmacophoric requirements of this new antagonist.
As mentioned above, derivatives 9 and 10 described in
Table 1 confirmed the need for a bulky lipophilic group
in position C-4 of the pyrrolic template, while position
C-2 was quite tolerant to substitution, accepting both
aromatic and non-aromatic groups as demonstrated by
derivatives 2, 7, 8, 12 and 13. The combinatorial
exploration (1600 derivatives) of the scaffold according
to the methodology described above for the selection of
the alcohols, fully confirmed our preliminary findings
and allowed the identification of the pinacolyl alcohol
as the best substituent for the C-4 position. The potency
values obtained after the enantiomeric resolution of
derivative 3, confirmed by the asymmetric synthesis of
derivatives 15 and 16, indicate that the area of the
receptor mapped by the C-4 substituent not only needed
bulky/lipophilic substituents, but also might have some
specific stereochemical requirements, as one enantiomer
was slightly more potent than the other.
Figure 6. Chronic constriction injury (CCI) model in rats. Treated
animals (blue dotted lines) showed the analgesic long-lasting effect of
derivative 3 (10 mg/kg; ip) with respect to the untreated control ani-
mals (red line).

178
F. Micheli et al. / Bioorg. Med. Chem. 11 (2003) 171–183
In order to better understand the needs of this newly
discovered region of mGluR1, an array exploration was
performed, keeping the n-Pr substituent in position C-2
fixed. A set of different alcohols, all identified among
the a-branched ones and not present in the original
R5OH set used for the original library, was selected on
the basis of commercial availability and molecular
weight filters. A number of interesting products were
prepared and it is worth commenting on the results
obtained with two of them. First of all, the pinacolyl
group could be removed without great loss of potency,
and the removal of a methyl group from the pinacolyl
alcohol led to a slight decrease in potency (17 vs 3).
Secondly, we obtained a further confirmation of the
precise stereochemical requirements in the region of the
receptor that interacted with this class of compounds.
Not only did a diastereomeric mixture lead to a decrease
of potency as expected, but the removal of two methyl
groups (compared to the pinacolyl structure) and the
occupancy of a different spatial region led to a marked
decrease (18 vs 3).
The poor stability of derivative 3 to rat plasma esterases
detrermined in rat ‘cassette dosing’ (t1/2=12 min versus
2.8 h in mice) prevented oral administration in rats.
However, intraperitoneal administration led to sig-
nificant effects in both chronic and neurogenic pain
models, thus confirming that the distribution of the
molecule in the body (Vdss=1.9 l/kg, mean t1/2=1.9 h)
and the possible receptor occupancy (the measured
concentration of the compound both in the brain and in
the plasma 5min after an iv administration led to a
brain/plama concentration ratio of 20) is sufficient for a
good duration of action as reported in Figure 6. To face
the instability of the n-Pr ester to rat esterases, different
approaches were followed. In particular, for this di-ester
derivative class, the obvious substitution with more
hindered C-2 groups gave interesting results. Namely,
the substitution with a t-butyl ester led to derivative 19
which showed a very good stability (t1/2=5.0 h in rats
and >24 h in mice) and nanomolar potency at the
receptor.
Finally, further SAR on derivative 3 were performed
(e.g., the replacement of the pinacolyl alcohol in posi-
tion C-4, exploration of N-1, C-3 and C-5 positions)
and will be the subject of future communications.
Pharmacological characterisation of 3 demonstrated
that it non-competitively blocked glutamate stimulation
of recombinant mGluR1 probably by acting directly on
the receptor. In the presence of 3, the glutamate CRC
was shifted rightward and depressed. In addition, when
combined with the competitive antagonist, MCPG, 3,
produced a multiplicative effect in the rightward shift of
the glutamate CRC suggesting that the two compounds
acted at separate sites. The pyrrole derivative probably
did not block mGluR1 by inhibiting the second messenger
cascade, because it had no effect on two other Gq-linked
receptors, NK3 expressed in CHO cells and muscarinic
receptor endogenously expressed in cerebellar neurones.
Experimental
Cell culture
Rat cerebellar granule cells. Cultured cerebellar granule
cells were prepared from 8-day-old rats. Cells were see-
ded onto 24-well plates treated with poly-l-lysine at a
density of 5Â105 cells/well in 0.5 mL and cultured in
BME(Gibco BRL) containing 10% heat-inactivated
fetal bovine serum (FBS), 2 mM glutamine, 50 mg/mL
gentamicin and 25 mM KCl. 10 mM cytosine arabino-
side was added to the culture 16–18 h after seeding to
prevent the proliferation of non-neuronal cells. Experi-
ments were performed after 4 days of culture (4 DIV)
when the response of the granule cells to the mGluR1
agonists is maximal.
In order to demonstrate more directly that the pyrroles
interact with mGluR1, two chimeric receptors contain-
ing parts of mGluR1 and -2 were constructed. Chimera
one contained the extracellular glutamate binding
domain,11 the first TM domain and the first intracellular
loop of mGluR1 attached to the downstream portions
of mGluR2. To create chimera two, the second and
third intracellular loops and carboxy terminal tail of
mGluR1 were replaced by the corresponding regions of
mGluR2. The first chimera was unaffected by 3,
whereas the second chimera was inhibited. The
mechanism of 3 might be similar to that of CPCCOEt,
the first non-competitve mGluR1 antagonist, which was
shown to interact with two amino acids on the extra-
cellular surface of TMVII as described in the references
reported above.
CHO cell lines. CHO cells stably expressing rat-
mGluR1a were produced as reported by Ferraguti et
al.35 Rat-mGluR5b, and human-mGluR4 were cloned
by PCR and stably transfected in CHO cells with selec-
tion in G418. Rat-mGluR2-CHO cell line was kindly
provided by Prof. S. Nakanishi and human-NK3-CHO
cells were obtained from Dr S. Arkinstall (Glaxo Insti-
tute for Molecular Biology). All mGluRs CHO cell lines
were cultured in DMEM (Gibco) containing 2 mM
glutamine, 1% proline and 10% dialyzed FBS (Gibco).
NK3-CHO cells were cultured in aMEM (Gibco) con-
taining 2 mM glutamine and 10% FBS (Gibco).
The in vivo activity of 3 in different pain models also
confirmed the original antinociceptive properties of
mGluR1 antagonists27,28 In particular, when dosed
orally in mice, the activity of 3 in the early phase of the
formalin test indicated the possibility of intervening not
only in chronic/neuropathic forms of pain (as shown by
the results in the Carrageenan and CCI tests), but also
in acute types. Accordingly, mGluR1 antagonists could
be endowed with an ‘opiate’-like activity profile, but
devoid of dependence-inducing side effects.
Second messenger assays
Measurement of PLC activation through the accumula-
tion of cytidinediphospho-diacylglycerol. The receptor-
mediated activation of PLC was evaluated by measuring
the accumulation of cytidinediphospho-diacylglycerol

F. Micheli et al. / Bioorg. Med. Chem. 11 (2003) 171–183
179
(CDP-DAG), which is the liponucleotide precursor of
phosphatidylinositol diphosphate. CDP-DAG accumu-
lates in the presence of Li+ as a consequence of the
receptor mediated activation of PLC.32 As described in
detail by Ferraguti et al.,35 mGluR1/5-CHO cells (pla-
ted the day before in 24-well plates, 1Â105 cell/0.5 mL/
well) or cerebellar granule cells (after 4 DIV in 24-well
plates) were labelled for 1 h with 1 mCi/mL of [3H]cyti-
dine (NEN) in Locke’s solution (154 mM NaCl, 5 mM
KCl, 2.3 mM CaCl2, 1 mM MgCl2, 5 mM NaHCO3, 5
mM HEPES and 1 g/L glucose). After three washings
with the same buffer, the agonist dissolved in Locke’s
solution containing 10 mM LiCl, with or without
antagonist, was added for 1 h (500 mL/well). The reac-
tion was stopped by replacing the buffer with ice-cold
CHCl3/CH3OH/1 N HCl mixture (100:200:3 v/v). The
mixture was transferred into polypropylene tubes and
the well washed with other CHCl3/CH3OH/1 N HCl
mixture. After phase separation, obtained by adding
further water and chloroform, an aliquot of the
organic phase was transferred into clean tubes and
washed with 1 mL of CHCl3/HCl mixture (1:1 v/v).
Finally, 200 mL of the organic phase were transferred
to scintillation vials, evaporated and counted in a Beta-
counter. Under these conditions all the radioactivity
collected in the organic phase is constituted of
[3H]CDP-DAG.
concentration in the samples was determined by means of
a ‘cAMP [125I] SPA’ kit (code RPA 538, Amersham)
according to the manufacturer’s instructions.
Arachidonic acid release
Cells were cultured in 24-well plates (1Â105 cell/well)
and labelled by incubation for 4–5 h with serum-free
medium containing [3H] arachidonic acid (0.5 mCi/mL,
NEN)and supplemented with 2mg/mL of fatty acid free
BSA (FAF-BSA, Sigma). Cells were then washed three
times and stimulated for 25 min at 37ꢀC with agonists
with/without antagonists, in 500 mL/well of serum-free
medium containing FAF-BSA. At the end of the incu-
bation 400 mL were transferred from wells to ice cold tubes
and centriguged at 500g for 5 min. 350 mL of each sample
were finally removed and counted in a Beta-counter.
Construction of chimeric receptors
Construction of chimeric receptor 1. A common SacI site
in the cDNAs encoding human mGluR1 and human
mGluR2 was used to create chimera 1. A 1.8 kb
BamHI-SacI fragment coding for the ECD, 1st TM and
1st intracellular loop of human mGluR1 (...SREL627
)
was ligated to a 0.8 kb SacI-BamHI fragment encoding
TMs 2-7 and the carboxy-terminal (C-terminal) region
of human mGluR2 (606CYIL...).53,54
Intracellular calcium determination using FLIPRtech-
nology. CHO cell line expressing rat-mGluR1a receptor
was seeded into 96-well plates (5Â104 cells/well). The
following day, cells were washed and pre-incubated for
30 min at 37 ꢀC with 100 mL/well of culture medium
containing 2 mM Fluo-4, 0.02% pluronic acid (Mole-
cular Probes), 5 mM probenecid (Sigma) and 20 mM
HEPES. After the labelling, cells were washed with
HBSS (1.26 mM CaCl2, 0.81 mM MgSO4, 5.36 mM
KCl, 0.44 mM KH2PO4, 4.17 mM NaHCO3, 137 mM
NaCl, 0.34 mM Na2HPO4, 1 g/L glucose, pH=7.4)
containing 20 mM HEPES and 2.5 mM probenecid,
leaving 100mL/well of the same buffer into the cell
plate. After addition of various antagonist and agonist
compounds, the intracellular calcium dynamics were
measured as fluorescence changes during time, for all
the wells of the plate simultaneously, by using the
Fluorescent Imaging Plate Reader apparatus (FLIPR,
Molecular Devices, Sunnyvale, CA, USA).
Construction of chimeric receptor 2. To create chimera 2
we followed the PCR overlap extension method descri-
bed in Pin et al.55 After cloning into pBluescriptII KS,
the sequences of all amplified DNAs were checked in
both directions by fluorescent dye terminator cycle
sequencing. The regions of mGluR1a that were replaced
with the corresponding portions of mGluR2 are the
following: the i2 of mGluR1a 681RIAR . . . AWAQ706
was exchanged with the i2 of mGluR2 656RIAR . . .
PASQ689; the i3 of mGluR1a 773KTRN . . . NEAK785
was replaced with the i3 of mGluR2 748KTRK . . .
NEAK760; the C-terminus of mGluR1a 841KPER . . .
SSTL1194 was substituted with the C-terminus of
mGluR2 820QPQK . . . TSSL872
.
List of primer sequences used to create chimera 2. Oligo-
nucleotide primers used to generate chimera 2 are pre-
sented in the 50 to 30 direction. The junction between
mGluR1 and mGluR2 sequences are indicated by a ‘-’.
2S (CGGGAGCTCTGCTACATCATCCTA)
2AS (CGAAGATGCGTGCAATGCG-ATTGGTTTT
AGTCACTAAAGCAGAGTAGCAC)
Measurement of cAMP formation for selectivity assay
on group II and III mGluRs. CHO cell lines expressing
human-mGluR4 and rat-mGluR2 receptors were seeded
in 96-well plates (5Â104 cells/well). The following day
the cells were washed and preincubated for 20 min at
37 ꢀC in Locke’s solution (154 mM NaCl, 5 mM KCl,
2.3 mM CaCl2, 1 mM MgCl2, 5 mM NaCO3, 5 mM
HEPES and 1 g/L glucose) containing 200 mM 3-iso-
butyl-1-methylxantine (IBMX). The reaction was star-
ted by replacing the buffer with Locke’s solution
containing the test agents (15 mM forskolin agonist
antagonist) and 100 mM IBMX. After a 20 min incu-
bation at 37ꢀC the solution was aspirated and the reaction
stopped using 100mL of ‘Lysis Reagent’ (included into the
Amersham cAMP kit) containing 200 mM IBMX. cAMP
3S (CGCATTGCACGCATCTTCG)
3AS (CTGTGAGGCAGGACTGATGAAGC)
4S (CTTCATCAGTCCTGCCTCACAG-GTGATCATT
GCCTCAATTCTGATTA)
4AS (GTATTGCAGATAAGGTAGACTTCCTTGAT
ACTTG)
5S (CCCAAGTATCAAGGAAGTCTACCTTATCTGC)
5AS (TGAAGTTTTCGGGGCACTTGCGAGTCTT-
GAAGGCATAGTAGGTACAGCTCATGA)
6AS (ACAAAAGCTAGCCAGATGATACAGGTGGT
GTACATGGTGAACGCGATATA-CTTGGCCTCGT
TGAAGTTTTCGGGGCACTTGCG)

180
F. Micheli et al. / Bioorg. Med. Chem. 11 (2003) 171–183
7S (TCCCAAGATGTACATCATTATTGCC-CAGCC
GCAGAAGAACGTG)
7AS (TTACTAGTGGATCCTCAAAGCGA)
mL), washed with a 2 M NaOH solution (2Â5 mL) and
then with brine (2Â5 mL). The organic phase was dried
over Na2SO4 and the solvent evaporated to obtain the
crude compound which was purified by column chroma-
tography (generally cyclohexane/ethyl acetate 9:1), to
give the desired compound.
Expression of receptors in oocytes. RNA was synthe-
sized in vitro from linearized DNA and injected into
Xenopus oocytes as described in Corti et al.56 mGluR1a
RNA was injected alone, while the RNAs coding for
mGluR2, chimera 1 and chimera 2 were all coinjected
with RNAs coding for 2 subunits of a G protein-coupled
inwardly-rectifying potassium channel, Kir 3.157 and
Kir 3.4.58
3,5-Dimethyl-pyrrole-2,4-dicarboxylic acid 4-ethyl ester
2-ethyl ester (1). Commercially available from Aldrich.
Mp 135 ꢀC.
3,5-Dimethyl-pyrrole-2,4-dicarboxylic acid 4-t-butyl ester
2-propyl ester (2). Prepared according to the general
procedure from 4-t-Bu-3,5-dimethyl-pyrrole-2,4-di-
carboxylic-acid as a white solid. Mp 116 ꢀC, NMR
CDCl3: d 8.79 (bs, 1H), 4.23 (t, 2H), 2.54 (s, 3H), 2.48
(s, 3H), 1.76 (m, 2H), 1.56 (s, 9H), 1.01 (t, 3H). IR
(CDCl3) cmÀ1, 3400 (NH), 1680 (C¼O). MS: m/z 281
[M]+, 282 [M+H]+.
Electrophysiological recordings. Recordings were made
2–4 days post injection for mGluR1a and mGluR2 and
10–11 days post injection for chimeras 1 and 2
employing glass electrodes filled with 3 M KCl and
having a resistance of 0.2–2 Mꢀ. Oocytes were held at
À60 mV to measure mGluR1a receptor activation,
while they were maintained at À80 mV to follow
receptor stimulation of mGluR2 and chimeras 1 and 2
in the two electrode voltage clamp mode. Drugs were
applied to mGluR1a RNA injected oocytes bathed in
ND96. To examine responses of mGluR2 and chimeras 1
and 2, oocytes were first clamped at À80 mV in ND96,
then a high potassium solution (2 mM NaCl, 96 mM
KCl, 1.8 mM CaCl2, 1 mM MgCl2 and 5 mM HEPES,
pH 7.5) was applied. After the basal current had stabi-
lized, drugs were applied in the high potassium solution.
3,5-Dimethyl-pyrrole-2,4-dicarboxylic acid 2-propyl ester
4-(1,2,2-trimethyl-propyl) ester (3). Prepared according
to the general procedure from 2-propyl-3,5-dimethyl-pyr-
role-2,4-dicarboxylic-acid as a white solid (yield=70%).
Mp 75ꢀC. NMR: CDCl3: d 8.82 (bs, 1H), 4.94 (q, 1H),
4.23 (t, 2H), 2.59 (s, 3H), 2.53 (s, 3H),1.76 (m, 2H), 1.22
(d,3H), 1.01 (t,3H), 0.97 (s, 9H). IR (CDCl3) cmÀ1, 3279,
1697, 1666. MS: m/z 310 [M+H]+, 309 [M]+.
3,5-Dimethyl-pyrrole-2,4-dicarboxylic acid 2-ethyl ester
(4). Commercially available from Maybridge.
Chemistry
Infrared spectra were recorded on a Bruker IFS 48
spectrometer. 1H NMR spectra were recorded on a
Varian Unity 400 (400 MHz); the data are reported as
follows: chemical shift in ppm from the Me4Si line as
external standard, multiplicity (b=broad, s=singlet,
d=doublet, t=triplet, q=quartet, m=multiplet) and
coupling constants.
3,5-Dimethyl-pyrrole-2,4-dicarboxylic acid 4-ethyl ester
(5). Prepared according to ref 59 as a light brown solid.
Mp 205 ꢀC.
3,5-Dimethyl-pyrrole-2,4-dicarboxylic acid (6). Commer-
cially available from Chem. Star.
3,5-Dimethyl-pyrrole-2,4-dicarboxylic acid 2-benzyl ester
4-t-butyl ester (7). Prepared according to what reported
in ref 60 as a light brown solid. Mp 123 ꢀC, NMR CDCl3:
d 7.43–7.3 (m, 5H), 6.78 (bs, 1H), 5.30 (s, 2H), 2.56 (s, 3H),
2.47 (s, 3H), 1.56 (s, 9H). IR (CDCl3) cmÀ1, 3308 (NH),
1691, 1661 (C¼O). MS: m/z 329 [M]+, 274 [MHÀtBu]+.
Chromatography was carried out by use of the Merck
Silica Gel 60 (230–400 mesh). Mass spectra were per-
formed on a Triple Quadrupole (VG-4 Fison Instru-
ment, UK) equipped with Fast Atom Bombardment
(FAB) ionization. Elemental analyses were determined
by a EA 1108 Carlo Erba elemental analyzer. Melting
points were determined on a Buchi 530 apparatus (scale
0–250 ꢀC) and are uncorrected. All the reactions were
carried out under a controlled atmosphere in flame
dried glassware. Anhydrous solvents and reagents were
purchased from Aldrich. Reactions were monitored by
analytical thin-layer chromatography (TLC) using
Merck Silica Gel 60 F-254 glass plates (0.25 mm).
3,5-Dimethyl-pyrrole-2,4-dicarboxylic acid 2-allyl ester
4-t-butyl ester (8). Prepared according to the general
procedure from 4-t-Bu-3,5-dimethyl-pyrrole-2,4-dicar-
boxylic-acid as a yellow solid. Mp 77 ꢀC NMR: CDCl3:
d 8.84 (bs, 1H), 6.0 (m, 1H), 5.33 (m, 2H), 4.77 (m, 2H),
2.55 (s, 3H), 2.49 (s, 3H), 1.56 (s, 9H). IR (CDCl3)
cmÀ1, 3450 (NH), 1686 (C¼O). MS: m/z 279 [M]+, 223
[MÀtBu+H]+.
General procedure for the synthesis of the esters
3,5-Dimethyl-pyrrole-2,4-dicarboxylic acid 2-benzyl ester
4-allyl ester (9). Prepared according to the general pro-
cedure from 2-benzyl-3,5-dimethyl-pyrrole-2,4-dicar-
boxylic-acid as a white solid. Mp 100 ꢀC NMR: CDCl3: d
8.84 (bs, 1H), 7.45–7.3 (m, 5H), 6.02 (dd, 1H), 5.38 (dd,
1H), 5.32 (s, 2H), 5.26 (dd, 1H), 4.76 (m, 2H), 2.60 (s,
3H), 2.52 (s, 3H). IR (CDCl3) cmÀ1, 3300 (NH), 1703
(C¼O),1672 (C¼O). MS: m/z 314 [M+H]+,313 [M]+.
The appropriate carboxylic acid (1 mmol) was sus-
pended in dry toluene (8 mL), trifluoroacetic anhydride
(1.2 mmol) was added under a nitrogen atmosphere and
the suspension stirred until complete solubilisation
occurred at room temperature. The desired alcohol (1.2
mmol) was added, the solution was still stirred for 2 h at
room temperature and then diluted with ethyl acetate (8

F. Micheli et al. / Bioorg. Med. Chem. 11 (2003) 171–183
181
3,5-Dimethyl-pyrrole-2,4-dicarboxylic acid 2-benzyl ester
4-benzyl ester (10). Prepared according to the general
procedure from 2-benzyl-3,5-dimethyl-pyrrole-2,4-
dicarboxylic-acid as a white solid. Mp 118 ꢀC NMR:
CDCl3: d 8.88 (bs, 1H), 7.44–7.3 (m, 10H), 5.30 (s, 2H),
Hexane/isopropanol 90/10, flux: 1 mL/min). Retention
time: 6.43, e.e.=90%.
3,5-Dimethy-pyrrole-2,4-dicarboxylic acid 2-propyl ester
4-((R)-1,2,2-trimethyl-propyl) ester (16). Prepared
according to the general procedure from 2-Propyl-3,5-
5.28 (s, 2H), 2.57 (s, 3H), 2.48 (s, 3H). IR (nujol) cmÀ1
,
3312 (NH), 1701 (C¼O),1664 (C¼O). MS: m/z 363
dimethyl-pyrrole-2,4-dicarboxylic-acid as a a light
1
[M]+, 272 [MÀBn]+.
yellowish foam (yield=25%). H NMR: (CdCl3) 0.99
(S, 9H); 1.03 (t, 3H); 1.24 (d, 3H); 1.77 (m, 2H); 2.55
(s, 3H); 2.60 (s, 3H); 4.25 (t, 2H); 4.96 (q, 1H); 8.92
(bs, 1H). Configuration confirmed by experiment with
Eu(tfc)3. as shift reagent. IR (nujol): 3277, 2854,
1697, 1670. MS: m/z 309 [M]+, 310 [MH]+, 268, 226,
225, 250, 208. HPLC (pump: JASCO 980, detector:
JASCO UV-970, l=275 nm, integrator: PE941A,
column: Chiralpack AD, 25 cmÂ4.6 mm, part. size: 5
mm, temp autosampler: 25 ꢀC, temp column: 25 ꢀC,
inj. vol.: 20 mL, mobile phase: Hexane/isopropanol
3,5-Dimethyl-pyrrole-2,4-dicarboxylic acid 2-(2-furyl-
methyl) ester 4-t-butyl ester (11). Prepared according to
the general procedure from 4-t-Bu-3,5-dimethyl-pyrrole-
2,4-dicarboxylic-acid as a light yellow solid. Mp 115 ꢀC
NMR CDCl3: d 8.76 (bs, 1H), 7.44 (dd, 1H), 6.46 (d,
1H), 6.38 (dd, 1H), 5.24 (s, 2H), 2.53 (s, 3H), 2.47 (s,
3H), 1.56 (s, 9H). IR (CDCl3) cmÀ1, 3443 (NH), 1688
(C¼O). MS: m/z 319 [M]+, 320 [M+H]+.
3,5-Dimethyl-pyrrole-2,4-dicarboxylic acid 2-octyl ester
4-t-butyl ester (12). Prepared according to the general
procedure from 4-t-Bu-3,5-dimethyl-pyrrole-2,4-dicar-
boxylic-acid as a white solid. Mp 75 ꢀC, NMR: CDCl3:
d 8.78 (bs, 1H), 4.25 (t, 2H), 2.54 (s, 3H), 2.48 (t, 3H),
1.73 (m, 2H), 1.56 (s, 9H), 1.40–1.24 (m, 10H), 0.88 (m,
3H). IR (CDCl3) cmÀ1, 3450 (NH), 1685 (C¼O). MS:
m/z 351 [M]+, 352 [M+H]+.
90/10, flux:
e.e.=84%.
1
mL/min). Retention Time: 7.29,
3,5-Dimethyl-pyrrole-2,4-dicarboxylic-acid 4-(2, 3-dimethyl
propyl) ester 2-propyl ester (17). Prepared according to
the general procedure from 2-propyl-3,5-dimethyl-pyr-
role-2,4-dicarboxylic-acid as a light brown glassy foam
NMR CDCl3: d 8.88 (bs, 1H), 4.98 (m, 1H), 4.23 (t,
2H), 2.58 (s, 3H), 2.52 (s, 3H), 1.90 (m, 1H), 1.76 (m,
2H), 1.25 (d, 3H), 1.01 (t, 3H), 0.98 (d, 3H), 0.96 (t, 3H).
IR (CDCl3) cmÀ1, 3210 (NH), 1721 (C¼O) . MS: m/z
296 [M+H]+.
3,5-Dimethyl-pyrrole-2,4-dicarboxylic acid 2-phenyl ester
4-t-butyl ester (13). Prepared according to the general
procedure from 4-t-Bu-3,5-dimethyl-pyrrole-2,4-dicar-
boxylic-acid as a pink solid. Mp 125 ꢀC, NMR: CDCl3:
d 8.9 (bs, 1H), 7.41–7.17 (m, 5H), 2.63 (s, 3H), 2.53 (s,
3H), 1.58 (s, 9H). IR (CDCl3) cmÀ1, 3200 (NH), 1703
(C¼O), 1691 (C¼O). MS: m/z 316 [M+H]+.
3,5-Dimethyl-pyrrole-2,4-dicarboxylic-acid 4-(2-methyl
cyclopentyl) 2-propyl ester (18). Prepared according to
the general procedure from 2-propyl-3,5-dimethyl-pyr-
role-2,4-dicarboxylic-acid as a light brown glassy foam
NMR CDCl3: d 8.77 (bs, 1H), 5.38 and 5.30 (m, 1H),
4.23 (t, 2H), 2.56 and 2.55 (s, 3H), 2.51 and 2.50 (s, 3H),
1.78 (m, 2H), 1.08 and 1.04 (d, 3H), 1.01 (t, 3H), 2.04–
0.8 (m, 7H). IR (CDCl3) cmÀ1, 3150 (NH), 1690 (C¼O).
MS: m/z 308 [M+H]+.
3,5-Dimethyl-pyrrole-2,4-dicarboxylic acid 2-(trimethyl
silyl ethyl) ester (14). 3,5-Dimethyl-2,4-dicarboxylic
acid 2-(trimethyl silyl ethyl) 4-benzyl ester (200 mg) was
dissolved in AcOEt (10 mL) and hydrogenated at
atmospheric pressure and room temperature for 5 h on
5% Pd on C. The suspension was filtered over Celite,
the organic phase dried over sodium sulphate and eva-
porated at reduced pressure to give the title compound
(yield=75%) as a white solid. Mp>250 ꢀC. NMR
DMSO-d6: d 11.91 (s, 1H), 11.71 (s, 1H), 4.27 (m, 2H),
2.47 (s, 3H), 2.37 (s, 3H), 1.05 (m, 2H), 0.03 (s, 9H). IR
(Nujol) cmÀ1, 3292 (NH), 1653 (C¼O). MS: m/z 284
[M+H]+.
3,5-Dimethyl-pyrrole-2,4-dicarboxylic-acid 2-t-butyl es-
ter- 4-[1,2,2-trimethylpropyloxycarbonyl]-ester (19). Pre-
pared according to the general procedure from 2-t-Bu-
3,5-dimethyl-pyrrole-2,4-dicarboxylic-acid as
a pink
solid (yield=75%). Mp 133 ꢀC NMR: DMSO-d6: d 11.6
(bs, 1H), 4.77 (q, 1H), 2.43 (s, 3H), 2.40 (s, 3H), 1.5(s,
9H), 1.12 (d, 3H), 0.91 (s, 9H). IR (nujol) cmÀ1, 3310,
1699,1657. MS: m/z 324 [M+H]+, 323 [M]+.
3,5-Dimethyl-pyrrole-2,4-dicarboxylic acid 2-propyl ester
4-((S)-1,2,2-trimethyl-propyl) ester (15). Prepared
according to the general procedure from 2-propyl-3,5-
dimethyl-pyrrole-2,4-dicarboxylic-acid as a white foam
Other esters reported in the Experimental and used as
intermediates.
1
(yield=27%). H NMR (CdCl3) 0.99 (S, 9H); 1.03 (t,
3,5-Dimethyl-pyrrole-2,4-dicarboxylic-acid 2-propyl es-
ter. 2 (182 mg) was dissolved in trifluoroacetic acid (3
mL) at rt. After stirring for 30 min, the reaction mix-
ture was poured into water (7 mL) and the resulting
white precipitate was filtered off to give the title com-
pound (110 mg) as a white solid. Mp>250 ꢀC. NMR:
DMSO-d6: d 11.92 (bs, 1H), 11.71 (bs, 1H), 4.14 (t,
2H), 2.45 (s, 3H), 2.39 (d, 3H), 1.067 (m, 2H), 0.95 (t,
3H). IR (nujol) cmÀ1, 3296, 2600,1657. MS: m/z 225
[M]+.
3H); 1.24 (d, 3H); 1.77 (m, 2H); 2.55 (s, 3H); 2.60 (s,
3H); 4.25 (t, 2H); 4.96 (q, 1H); 8.92 (bs, 1H). Configur-
ation confirmed by experiment with Eu(tfc)3 as shift
reagent. IR (nujol): 3277, 2854, 1697, 1670. MS: m/z 309
[M]+, 310 [MH]+, 268, 226, 225, 250, 208. HPLC
(pump: JASCO 980, detector: JASCO UV-970, l=275
nm, integrator: PE941A, column: Chiralpack AD, 25
cmÂ4.6 mm, part. size: 5 mm, temp. autosampler: 25 ꢀC,
temp. column: 25 ꢀC, inj. vol.: 20 mL, mobile phase:

182
F. Micheli et al. / Bioorg. Med. Chem. 11 (2003) 171–183
3,5-Dimethylpyrrole-2,4-dicarboxylic-acid 2-benzyl ester.
Derivative 7 (150 mg) was dissolved in trifluoroacetic
acid (3 mL) at rt. After stirring for 30 min, the reaction
mixture was poured into water (10 mL) and the result-
ing white precipitate was filtered off to give the title
compound (yield=93%) as a white solid. Mp>250 ꢀC.
References and Notes
1. Wheal, H.V., Thomson, A.M., Eds. ExcitatoryAmino
Acids Synaptic Transmission, 1995, Academic press, London
2. Meldrum, B. S., Ed. ExcitatoryAmino Acids Antagonists .
Blackwell: Oxford, 1991.
3. Di Fabio, R.; Capelli, A. M.; Conti, N.; Cugola, A.;
Donati, D.; Feriani, A.; Gastaldi, P.; Gaviraghi, G.; Hewkin,
C. T.; Micheli, F.; Missio, A.; Mugnaini, M.; Pecunioso, A.;
Quaglia, A. M.; Ratti, E.; Rossi, L.; Tedesco, G.; Trist, D. G.;
Reggiani, A. J. Med. Chem. 1997, 40, 841.
4. Micheli, F.; Di Fabio, R.; Capelli, A. M.; Cugola, A.;
Cucuruto, O.; Feriani, A.; Gastaldi, P.; Gaviraghi, G.;
Marchioro, C.; Orlandi, A.; Pozzan, A.; Quaglia, A. M.;
Reggiani, A.; van Amsterdam, F. Arch. Pharm. Pharm. Med.
Chem. 1999, 332, 73.
5. Donati, D.; Micheli, F. Exp. Opin. Ther. Pat. 2000, 10, 667.
6. Nakanishi, S.; Masu, M. Annu. Rev. Biophys. Biomol.
Struct. 1994, 23, 319.
7. Hollmann, M.; Heinemann, S. Annu. Rev. Neurosci. 1994,
17, 31.
8. Pin, J. P.; Duvoisin, R. Neuropharmacology 1995, 34, 1.
9. Knoepfel, T.; Kuhn, R.; Allgeier, H. J. Med. Chem. 1995,
38, 1417.
10. Conn, P. J.; Pin, J. P. Annu. Rev. Pharmacol. Toxicol.
1997, 37, 205.
11. O’Hara, P. J.; Sheppard, P. O.; Thogersen, H.; Venezia,
D.; Haldeman, B. A.; McGrane, V.; Houamed, K. M.;
Thomsen, C.; Gilbert, T. L.; Mulvihill, E. R. Neuron 1993, 11,
41.
12. Kunishima, N.; Shimada, Y.; Tsuji, Y.; Sato, T.; Yama-
moto, M.; Kumasaka, T.; Nakanishi, S.; Jingami, H.; Mor-
ikawa, K. Nature (London) 2000, 407, 971.
13. Brown, E. M.; Gamba, G.; Riccardi, D.; Lombardi, M.;
Butters, R.; Kifor, O.; Sun, A.; Hediger, M. A.; Lytton, J.;
Herbert, S. C. Nature (London) 1993, 366, 575.
14. Kaupmann, K.; Huggel, K.; Heid, J.; Flor, P. J.; Bischoff,
S.; Mickel, S. J.; McMaster, G.; Angst, C.; Bittiger, H.;
Froestl, W.; Bettler, B. Nature (London) 1997, 386, 239.
15. Bargmann, C. Cell 1997, 90, 585.
16. Brauner-Osborne, H.; Egebjerg, J.; Nielsen, E.Ø.; Mad-
sen, U.; Krogsgaard-Larsen, P. J. Med. Chem. 2000, 43,
2609.
17. Schoepp, D. D.; Jane, D. E.; Monn, J. A. Neuropharma-
cology 1999, 38, 1431.
18. Brauner-Osborne, H.; Krogsgaard-Larsen, P. British J.
Pharmacol. 1998, 123, 269.
19. Brabet, I.; Mary, S.; Bockaert, J.; Pin, J. P. Neuro-
pharmacology 1995, 34, 895.
20. Hayashi, Y.; Sekiyama, M.; Nakanishi, S.; Jane, D. E.;
Sunter, D. C.; Birse, E. F.; Udvarhelyi, P. M.; Watkins, J. C.
J. Neurosci. 1994, 14, 3370.
21. Pellicciari, R.; Raimondo, M.; Marinozzi, M.; Natalini,
B.; Costantino, G.; Thomsen, C. J. Med. Chem. 1996, 39,
2874.
NMR: DMSO-d6: d 11.8 (bs, 1H), 7.42 (m, 5H), 5.28 (s,
2H), 2.45 (s, 3H), 2.39 (s, 3H). IR (nujol) cmÀ1, 3290
(NH), 1657 (C¼O). MS: m/z 274 [M+H]+, 273 [M]+.
3,5-Dimethyl-pyrrole-2,4-dicarboxylic acid 2-(trimethyl
silyl ethyl) 4-benzyl ester. Prepared from the commer-
cially available 3,5-dimethyl-pyrrole-2,4-dicarboxylic-
acid 4-benzyl ester according to the general procedure
as a yellow solid. Mp 138 ꢀC NMR CDCl3: d 8.9 (bs,
1H), 7.42–7.32 (m, 5H), 5.29 (s, 2H), 4.35 (m, 2H), 2.57
(s, 3H), 2.50 (s, 3H), 1.1 (m, 2H), 0.06 (s, 9H). IR
(CDCl3) cmÀ1, 3300 (NH), 1697 (C¼O), 1659 (C¼O).
MS: m/z 374 [M+H]+.
3,5-Dimethyl-pyrrole-2,4-dicarboxylic-acid 4-t-Bu-ester.
Derivative 7 (200 mg) was dissolved in AcOEt (10 mL)
and hydrogenated at atmospheric pressure and room
temperature for 5 h on 5% Pd on C. The suspension
was filtered over Celite, the organic phase dried over
sodium sulphate and evaporated at reduced pressure to
give the title compound as a light brown solid
(yield=95%).=Mp>120 ꢀC NMR: DMSO-d6: d 12.35
(bs, 1H), 11.65 (s, 1H), 2.40 (s, 3H), 2.34 (s, 3H), 1.47 (s,
9H). IR (nujol) cmÀ1, 3500 (OH), 3200 (NH), 1680
(C¼O). MS: m/z 239 [M]+.
3,5-Dimethyl-pyrrole-2,4-dicarboxylic-acid 2-tert-butyl
ester 4-benzyl ester. To a solution of t-butylacetoace-
tate (20.7 mL) in acetic acid (35 mL) kept at costant
temperature of 10 ꢀC, sodium nitrite (9.5 g) was slowly
added under vigorous stirring. The mixture was left at
10 ꢀC for 24 h and then added to a suspension formed
by Zn (24.25 g), benzylacetoacetate (21.6 mL) and
ammonium acetate (19.25 g) in acetic acid (62.5 mL)
kept at 65 ꢀC. The temperature was raised suddenly to
90 ꢀC and stirred at the same temperature for 5 h. The
mixture was then cooled to 50 ꢀC and poured onto ice
and the crude material was crystallised from aq metha-
nol to give the title compound (14.7 g) as a white solid.
NMR: CDCl3: d 8.78 (bs, 1H), 7.49 (d, 2H), 7.37 (t,
2H), 7.31 (m, 1H), 5.29 (s, 2H), 2.53 (s, 3H), 2.49 (s,
3H), 1.57(s, 9H).IR (nujol) cmÀ1, 3317, 3296, 1655. MS:
m/z 236 [M+H]+, 235 [M]+.
22. Eaton, S. A.; Jane, D. E.; Jones, P. L. S. J.; Porter,
R. H. P.; Pook, P. C. K.; Sunter, D. C.; Udvarhelyi, P. M.;
Roberts, P. J.; Salt, T. E.; Watkins, J. C. Eur. J. Pharmacol.,
Mol. Pharmacol. Sect. 1993, 244, 195.
23. Costantino, G.; Maltoni, K.; Marinozzi, M.; Camaioni,
E.; Prezeau, L.; Pin, J.-P.; Pellicciari, R. Bioorg. Med. Chem.
2001, 9, 221.
3,5-Dimethyl-pyrrole-2,4-dicarboxylic-acid 2-t-butyl ester.
3,5-Dimethyl pyrrole-2,4-dicarboxylic-acid 2-tert-butyl
ester-4-benzyl ester (9.6 g) was dissolved in THF (250 mL)
and hydrogenated over 10% Pd on C (1 g) for 8 h. The
solution was filtered and the solvent evaporated to dryness.
The crude product was dissolved in ethyl acetate and pet-
roleum ether (300 mL) was added. The resulting precipitate
was filtered off to give the title compound (6.7 g) as a white
solid. NMR: DMSO-d6: d 11.86 (bs, 1H),11.51 (bs, 1H),
24. Clark, B. P.; Harris, J. R.; Kingston, A. E.; McManus, D.
XVth Eur. Int. Symp. Med. Chem 1998, 183.
25. Litschig, S.; Gasparini, F.; Rueegg, D.; Stoehr, N.; Flor,
P. J.; Vranesic, I.; Prezeau, L.; Pin, J. P.; Thomsen, C.; Khun,
R. CPCCOEt. Mol. Pharmacol. 1999, 55, 453.
26. De Vry, J.; Horvath, E.; Schreiber, R. Eur. J. Pharmacol.
2001, 428, 203.
2.40 (s, 3H), 2.37 (s, 3H), 1.49 (s, 9H). IR (nujol) cmÀ1
3317, 3296, 1655. MS: m/z 236 [M+H]+, 235 [M]+.
,

F. Micheli et al. / Bioorg. Med. Chem. 11 (2003) 171–183
183
27. Nicoletti, F.; Bruno, V.; Copani, A.; Casabona, G.;
Knopfel, T. Trends Neurosci. 1996, 19, 267.
28. Pellegrini-Giampietro, D. E.; Cozzi, A.; Peruginelli, F.;
Leonardi, P.; Meli, E.; Pellicciari, R.; Moroni, F., 1 Eur. J.
Neurosci. 1999, 11, 3637.
29. Young, M. R.; Fleetwood-Walker, S. M.; Mitchell, R.;
Munro, F. E. Neuropharmacology 1994, 33, 141.
30. Valerio, A.; Paterlini, M.; Biofava, M.; Memo, M.; Spano,
P. Neuroreport 1997, 8, 2695.
43. Pizzi, M.; Galli, P.; Consolandi, O.; Arrighi, V.; Memo,
M.; Spano, P. F. Mol Pharmacol. 1996, 49, 586.
44. Toms, N. J.; Jane, D. E.; Tse, H. W.; Roberts, P. J. British
J Pharmacol. 1995, 116, 2824.
45. The research complied with national legislation and with
company policy on the Care and Use of Animals and with
related codes of practice.
46. Hunskaar, S.; Fasmer, O. B.; Hole, K. J. Neurosci. Methods
1985, 14, 69.
31. Mao, L.; Conquet, F.; Wang, J. Q. Neuroscience 2001,
106, 303.
47. Hunskaar, S.; Hole, K. Pain 1987, 30, 103.
48. Arrigonimartelli, E.; Conti, I. Farmaco, Edizione pratica
Mar 1964, 19134.
49. Perrot, S.; Guilbaud, G.; Kayser, V. Pain 1999, 83, 249.
50. Mao, J.; Price, D. D.; Hayes, R. L.; Lu, J.; Mayer, D. J.
Brain. Res. 1992, 598, 271.
51. Bordi, F.; Quartaroli, M. Pain 2000, 84, 213.
52. Seebach, B. S.; Mendell, L. M. J. Neurophysiol. 1996, 76,
3875.
32. Fundytus, M. E.; Yashpal, K.; Chabot, J.-G.; Osborne,
M. G.; Lefebvre, C. D.; Dray, A.; Henry, J. L.; Coderre, T. J.
British Journal of Pharmacology 2001, 132, 354.
33. Costantino, G.; Macchiarulo, A.; Pellicciari, R. J. Med.
Chem. 1999, 42, 2816.
34. Costantino, G.; Pellicciari, R. J. Med. Chem. 1999, 32,
5390.
35. Ferraguti, F.; Cavanni, P.; Eistetter, H.; Salvagno, C.;
Ratti, E.; Trist, D. G. Mol. Cell. Neurosci. 1994, 5, 269.
36. Jensen, A. M.; Chiu, S. Y. J.Neurosci. 1990, 10, 1165.
37. Chu, E. J.-H.; Chu, T. C. J. Org. Chem. 1954, 19, 266.
38. Fisher, H.; Walach, B. Chem. Ber. 1925, 58, 2818.
39. Knorr, L. Justus Liebig Ann. Chem. 1886, 236, 290.
40. Di Simone, B.; Savoia, D.; Tagliavini, E.; Umani-Ronchi,
A. Tetrahedron: Asymmetry 1995, 6, 301.
41. Helke, C. J.; Krause, J. E.; Mantyh, P. W.; Couture, R.;
Bannon, M. J. FASEB Journal 1990, 4, 1606 Ref: 69.
42. Eaton, S. A.; Jane, D. E.; Jones, P. L.; Porter, R. H.;
Pook, P. C.; Sunter, D. C.; Udvarhely, P. M.; Roberts, P. J.;
Salt, T. E.; Watkins, J. C. Eur. J. Pharmacol. 1993, 244,
195.
53. Takahashi, K.; Tsuchida, K.; Tanabe, Y.; Masu, M.;
Nakanishi, S. J. Biol. Chem. 1993, 268, 19341.
54. Okamoto, T.; Sekiyama, N.; Otsu, M.; Shimada, Y.; Sato,
A.; Nakanishi, S.; Jingami, H. J. Biol. Chem. 1998, 273, 13089.
55. Pin, J.-P.; Joly, C.; Heinemann, S. F.; Bockaert, J. EMBO
J. 1994, 13, 342.
56. Corti, C.; Restituito, S.; Rimland, J. M.; Brabet, I.; Corsi,
M.; Pin, J.-P.; Ferraguti, F. Eur. J. Neurosci 1998, 10, 3629.
57. Kubo, Y.; Reuveny, E.; Slesinger, P. A.; Jan, Y. N.; Jan,
L. Y. Nature 1993, 364, 802.
58. Ashford, M. L. J.; Bond, C. T.; Blair, T. A.; Adelman, J. P.
Nature 1994, 370, 456.
59. Cordell, G. A J. Org. Chem. 1975, 40, 3161.
60. Smith, M. K.; Bisset, G. M. F. J. Org. Chem. 1979, 44, 2077.