Inhibitory effect of flavonoids on human glutaminyl cyclase

Article abstract of DOI:10.1016/j.bmc.2016.03.064

Glutaminyl cyclase (QC) plays an important role in the pathogenesis of Alzheimer's disease (AD) and can be a potential target for the development of novel anti-AD agents. However, the study of QC inhibitors are still less. Here, phenol-4′ (R1-), C5-OH (R2-) and C7-OH (R3-) modified apigenin derivatives were synthesized as a new class of human QC (hQC) inhibitors. The efficacy investigation of these compounds was performed by spectrophotometric assessment and the structure-activity relationship (SAR) was evaluated. Molecular docking was also carried out to analyze the binding mode of the synthesized flavonoid to the active site of hQC.

Full text of DOI:10.1016/j.bmc.2016.03.064

Bioorganic & Medicinal Chemistry 24 (2016) 2280–2286
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Inhibitory effect of flavonoids on human glutaminyl cyclase
Manman Li a,b,y, Yao Dong a,b,y, Xi Yu a,b, Yongdong Zou a, Yizhi Zheng a, Xianzhang Bu c, Junmin Quan d,
Zhendan He b, Haiqiang Wu a,b,
⇑
a College of Life Sciences, Shenzhen University, Shenzhen 518060, China
b Department of Pharmacy, School of Medicine, Shenzhen University, No. 3688, Nanhai Road, Nanshan, Shenzhen 518060, China
c School of Pharmaceutical Science, Sun Yat-sen University, Guangzhou 510006, China
d Key Laboratory of Structural Biology, School of Chemical Biology & Biotechnology, Peking University, Shenzhen Graduate School, Shenzhen 518055, China
a r t i c l e i n f o
a b s t r a c t
Article history:
Glutaminyl cyclase (QC) plays an important role in the pathogenesis of Alzheimer’s disease (AD) and can
be a potential target for the development of novel anti-AD agents. However, the study of QC inhibitors are
still less. Here, phenol-40 (R1-), C5-OH (R2-) and C7-OH (R3-) modified apigenin derivatives were synthe-
sized as a new class of human QC (hQC) inhibitors. The efficacy investigation of these compounds was
performed by spectrophotometric assessment and the structure–activity relationship (SAR) was evalu-
ated. Molecular docking was also carried out to analyze the binding mode of the synthesized flavonoid
to the active site of hQC.
Received 8 March 2016
Revised 30 March 2016
Accepted 30 March 2016
Available online 1 April 2016
Keywords:
Glutaminyl cyclase
Flavonoids
Ó 2016 Elsevier Ltd. All rights reserved.
Synthesis
Enzyme inhibitor
Alzheimer’s disease
1. Introduction
However, recent evidence indicates that pE-Abs exhibit an
increased neurotoxicity, hydrophobicity, accelerated aggregation
Glutaminyl cyclase (QC, EC 2.3.2.5) is one kind of acyltrans-
ferases, which catalyzes intramolecular cyclization of N-terminal
glutamine residues to pyroglutamic acid (pGlu) with the concomi-
tant liberation of ammonia.1 This post-translational formation of
pGlu is an important process for the maturation of various bioac-
tive neuropeptides, hormones, cytokines and for their biological
activity, because the pGlu is required to protect the N termini from
exopeptidase degradation and/or to develop the proper conforma-
tion. QC is abundant in mammalian secretory tissue such as secre-
tory glands or brain tissue including hippocampus and cortex.
Recently, the described ability of human QC (hQC) to convert the
N-terminal glutamate of b-amyloids (Abs) into respective pGlu-
kinetics, and resistance to degradation of aminopeptidases as com-
pared to native Abs.6,7 pE-Abs are really the main components of
the plaques in the AD brains (more than 60%).8 The formation of
pE-Abs is likely to be a crucial event in the progress of the disease.
Furthermore, it is demonstrated that the expression of QC is
characteristically up-regulated in the early stage of AD and the
hallmark of the inhibition of QC is the prevention of the formation
of pE-Abs and plaques.9,10 The application of QC inhibitors as a new
therapeutic strategy has been proved to be effective in different
transgenic animal models, even in Phase I clinical trial in AD
patients.9,11,12 Unfortunately, only a few of imidazole derivatives
were reported as QC inhibitors so far, for instance PBD150 (Fig. 1,
left).13–15
modified Abs (pE-Abs) suggests
a potential involvement of
hQC in the initiation of the formation of neurotoxic plaques in
Flavonoids exhibit plenty of desired pharmacological effects
including antioxidation and antiinflammation.16–19 According to
the new reports, the consumption of flavonoid-rich foods is associ-
ated with lower incidence of dementia in human beings.20,21 Cho-
linesterase inhibition and anti-amyloidogenic effects of flavonoids
have been recognized.22,23 Yet, the inhibitory effect of flavonoids
on QC has not been investigated.
Alzheimer’s disease (AD).2
AD, a progressive neurodegenerative disorder, is the most com-
mon cause of dementia among elderly people, and these are no
effective therapeutic modality for the prevention, halting or rever-
sal of AD currently.3,4 The extracellular plaques composed of neu-
rotoxic Ab have been supposed to be involved in the onset of AD.5
Interestingly, apigenin (Fig. 1, right) was founded to be effective
in the inhibition of hQC in our research (not published). We
hypothesize that flavonoids may be a new class of QC inhibitors.
Then, three series of apigenin derivatives, phenol-40 (R1), C5-OH
⇑
Corresponding author. Tel.: +86 755 8617 2799; fax: +86 755 8667 1901.
E-mail address: wuhq@szu.edu.cn (H. Wu).
Manman Li and Yao Dong contributed equally to this work.
y
http://dx.doi.org/10.1016/j.bmc.2016.03.064
0968-0896/Ó 2016 Elsevier Ltd. All rights reserved.

M. Li et al. / Bioorg. Med. Chem. 24 (2016) 2280–2286
2281
Table 1
3'
6'
OH
4'
5'
R1-modified apigenin derivatives and the inhibitory activities*
2'
1'
1
8
5
HO
O
2
7
9
O
O
Compd
R1
R2
R3
IR (%, SD)
S
4
OH
6
3
10
Apigenin
–OH
–OH
75.2 2.3
N
H
N
H
N
N
OH
O
1
2
–OH
–OH
–OH
–OH
93.0 2.0
85.2 3.6
Figure 1. Structures of PBD150 (left) and apigenin (right).
O
O
3
4
–OH
–OH
–OH
–OH
91.5 3.2
71.7 2.6
(R2) and C7-OH (R3) modified, were synthesized in the present
study. The evaluation of the potency of these inhibitors and the
analysis of structure–activity relationship (SAR) were performed.
The results of molecular docking provided further insights into
the interaction between flavonoids and hQC.
O
O
F
5
6
–OH
–OH
–OH
–OH
87.7 2.0
84.2 1.9
O
2. Results and discussion
2.1. Chemistry
S
7
8
–OH
–OH
–OH
–OH
–OH
–OH
92.6 1.1
91.6 2.8
92.4 1.4
S
The presence of phenolic hydroxyl is important for the mainte-
nance of the pharmacological effects of flavonoids. Phenol-40 (R1),
C5-OH (R2) and C7-OH (R3) modified apigenin derivatives were
synthesized here to access the influence of these phenolic hydrox-
yls on the inhibitory activities. The preparation of R1-modified
compounds 1–9 (Table 1) and R2-modified compounds 10–29
(Table 2) was conducted according to Scheme 1. These apigenin
derivatives were generated starting from the commercially avail-
able chemicals I by Hosech reaction and followed by the Baker–
Venkataraman rearrangement with chemicals IV to give an overall
yields of 60–81%.24–26 R3-modified chemicals 30–40 (Table 3) were
obtained from the reaction of the corresponding R2-modified com-
pounds with methyl iodide as methylating agent (scheme was not
shown here) in high yields (91–98%, but 38 in 50%). All the api-
genin derivatives were yellow/red powder or crystals.
S
9
*
Concentration: 100
l
M; IR: inhibitory rate.
and 24) was the same as that of derivatives 1–9. However, chemi-
cals in the absence of C5-OH exhibited a decreased inhibitory
potency obviously. So, C5-OH would be favored for the potential
inhibitory activities of apigenin derivatives. The position of
substituents on R1 affected the inhibitory activities of these
compounds slightly, such as 12, 15, 19, 24 versus 14, 16, 21, 26
respectively. It could be seen that the introduction of para-
substituents on R1 led to an increased potency. Moreover, the
inhibitory activity of the compounds was negatively correlated with
the hydrophobicity of R1. This tendency was opposite from the
tendency in the R1-modified apigenin derivatives mentioned above.
The impact of C7-OH on the activity of the apigenin derivatives
was further explored. Methylation of C7-OH resulted in a total loss
of potency in case of the R3-modified compounds. All of these
The benzo-c-pyrone skeletons of apigenin derivatives were not
changed, as hQC prefers substrates with an aromatic ring besides
the zinc ion in the active site.27 The backbone is also needed for fla-
vonoids to exhibit the pharmacological activities.
2.2. QC inhibitory activities and SAR analysis
derivatives exhibited no obvious inhibitory activities at 100 lM
including 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 (Table 3) com-
pared with compounds 8, 12, 14, 15, 17, 19, 20, 22, 25, 27, 28,
respectively. Therefore, C7-OH was found to be crucial for the inhi-
bitory activities of apigenin derivatives and for the binding of fla-
vonoids at the active site of hQC. According to all these results,
the structure–activity relationship of apigenin-based hQC inhibi-
tors could be shown in Figure 2.
In this study, recombinant hQC was expressed in Escherichia coli
cells and used as the source of QC for our assays in vitro according
to the previous reports.28–30 The efficacy of these apigenin deriva-
tives were evaluated using spectrophotometric assessment as
described by Schilling et al.31 IC50 values were determined from
the inhibitory dose response curves.
The R1-modified chemicals were found to be of high potency
(Table 1). Compounds containing alkyl groups on R1, 1 & 2, exhib-
ited an increased potency as compared to apigenin. Alkylation of p-
phenolic hydroxyl on R1 (3) improved the inhibitory activity of the
compound. The exchange of the phenyl motif by thiophene also
resulted in an improvement of the inhibitory activities, such as 7,
8 and 9. The hydrophobicity of R1, the number and/or position of
the alkoxy groups all exhibited a slightly impact on the inhibitory
potency, including 3, 4 and 5, but the inhibitory activities of
R1-modified apigenin derivatives in the presence of C5-OH and
C7-OH has been proved overall.
The influence of C5-OH on the activity was found to be more
pronounced in the case of R2-modified apigenin derivatives
(Table 2). The replacement of C5-OH by H resulted in a moderate
drop of potency in general. The inhibitory activities of these com-
pounds decreased nearly half of the activities of the derivatives
containing C5-OH, such as 2, 3, 5, 6 versus 10, 13, 16, 21, respec-
tively. It was denoted that the potency of some compounds (23
Then, IC50 values (Table 4) of these apigenin derivatives
(IR P80% at 100
response curves. Generally, these selected derivatives exhibited
IC50 values ranging from 14.2 to 45.2 M and most of the com-
lM) were determined from the inhibitory dose
l
pounds contained C5-OH and C7-OH. The IC50 value of 11 was
almost 3-fold weaker than that of 3, which was turned out to be
the most potent compound. However, the IC50 value of 3 was 3-fold
lower than that of PBD150. Based on the difference in the inhibi-
tory potency between apigenin derivatives and positive control,
there may be different inhibitory mechanisms and/or different
binding strength for the synthesized flavonoids because of their
particular structures.
2.3. Molecular docking
It is suggested that hQC contains one zinc ion at the bottom of
the active site. According to these findings, a limited number of

2282
M. Li et al. / Bioorg. Med. Chem. 24 (2016) 2280–2286
compounds.13 In view of the totally different schedule of apigenin
derivatives, molecular docking was performed to evaluate the
combination of apigenin derivatives and hQC.
The hQC mode reveals a typical ‘open sandwich’ structure.
There is a hydrophobic core consisting of four parallel, two antipar-
allel b-sheets and the surrounding eight a-helices. The active site is
characterized by a deep, tight, and angled cleft, which is defined by
the hydrophobic amino acids Trp329, Val302, Asp305. Compound 1
was docked into the active site of hQC as shown in Figure 3 here.
It can be seen that at the entrance of the cavity there is an open
space which is not only suitable for the location of m-methylbenzol
(R1) in compound 1 but also suitable for the location of other aro-
matic moieties. Thus, the modification of R1 exhibited a slightly
effect on the inhibitory activities of apigenin derivatives containing
C5-OH and C7-OH. And the introduction of p-substituents in R1
resulted in an improvement of the potency for the good match of
p-substituents in this open space.
Table 2
R2-modified apigenin derivatives and the inhibitory activities*
Compd
10
R1
R2
–H
–H
–H
–H
R3
IR (%, SD)
79.5 4.1
71.8 1.5
75.2 8.9
67.6 5.7
–OH
–OH
–OH
–OH
OH
11
O
O
12
13
14
15
16
–H
–H
–H
–OH
–OH
–OH
54.5 1.2
68.3 1.1
54.3 5.4
O
O
O
O
In this binding mode, the access to the active cavity was blocked
O
O
by the benzo-
direct interactions between compound 1 and QC in this hydropho-
bic pocket, including the stack interaction between the pheno-
c-pyrone moiety of compound 1. There were several
O
17
–H
–OH
68.7 2.3
p–p
O
S
lic moiety and the indole ring of Trp207, hydrogen bond between
the oxygen atom at C4 carbonyl and the water molecule which
was shared with amine of Gln304, and hydrogen bond between
the C5-OH (R2) and the carbonyl oxygen atom of Gln304. Because
of the important assistance of hydrogen bond, C5-OH was favored
for the inhibitory activities of apigenin derivatives. Compared with
R1-modified compounds, as a result, the R2-modified compounds
exchanged C5-OH by H were found to be of medium potency.
Furthermore, the binding of C7-OH with zinc ion, which was
located at the bottom of active cavity by Asp159, Glu202 and
His330, might be the most important interaction between the
ligand and QC. This binding was similar to the binding of imidazole
of PBD150 with zinc ion in the active pocket. Supporting this, R7-
modified compounds were found to be totally inactive when the
hydroxyls were methylated. Therefore, C7-OH was essential for
the inhibitory potency of apigenin derivatives. Difference in the
binding strength of oxygen and nitrogen with the zinc ion may
partly contribute to the difference in the inhibitory potency of
these flavonoids and positive control. Consequently, molecular
docking proved the research results and conformed the SAR of api-
genin derivatives as potential hQC inhibitors (Fig. 2).
18
19
20
–H
–H
–H
–OH
–OH
–OH
75.8 2.8
74.2 3.5
63.3 2.7
F
F
21
–H
–OH
60.8 3.2
F
22
23
–H
–H
–OH
–OH
70.8 1.5
90.3 4.0
CF3
N
N
24
25
–H
–H
–OH
–OH
87.1 5.7
65.2 1.6
N
N
26
–H
–OH
62.4 2.4
O
27
28
29
–H
–H
–H
–OH
–OH
–OH
68.7 3.4
61.4 2.4
78.9 1.8
O
O
3. Conclusion
*
Concentration: 100 lM.
Based on the research mentioned above, it could be concluded
that the effect of R1 on the inhibitory activity of apigenin deriva-
tives is slight, but R2 (C5-OH) is favored and especially, R3 (C7-
OH) is essential for the inhibitory potency. These results thus
strongly implied that apigenin derivatives containing C5-OH and
imidazole-derived chemicals including PBD150 were synthesized
and tested as QC inhibitors.13–15 The binding of imidazole with
Zn2+ ion mainly contributed to the inhibitory activities of these
R3
OH
O
R3
OH
NH
R3
OH
(ii)
(i)
Cl
+
N
Cl
Cl
R2
R2
R2
I
II
III
R3
O
O
R1
(iii)
R1 = phenol, benzaldehyde, imidazole,
furane, thiophene and pyridine and
derivatives.
OHC R1
+
R2
IV
V
Scheme 1. Reagents and conditions: (i) ZnCl2, Et2O filled with HCl gas, rt; (ii) 10% HCl/H2O, 60 °C, 10–12 h; (iii) H2O/EtOH (1:5, V/V), 5% NaOH, rt.

M. Li et al. / Bioorg. Med. Chem. 24 (2016) 2280–2286
2283
Table 3
at room temperature until III and IV were both disappeared ana-
lyzed by TLC. EtOH was removed at reduced pressure, a large
amount of water was added, then the mixture was neutralized to
neutral or weak acid with 10% HCl/H2O solution and the resulting
precipitate (V) was filtered off, washed several times with water,
purified by crystallization with EtOH or column chromatography
with n-hexane/ethyl acetate.
For the C7-phenolic hydroxyl methylated compounds, corre-
sponding derivatives synthesized by the procedure mentioned
above was used as starting material, and methyl iodide was used
as methylating agent in the presence of K2CO3. Spectroscopic data
of old compounds were previously reported in the literatures, and
those of new compounds are listed below.
R3-modified apigenin derivatives and the inhibitory activities*
Compd
R1
R2
R3
IR (%, SD)
—
S
30
–H
–OCH3
O
31
32
33
–H
–H
–H
–OCH3
–OCH3
–OCH3
—
—
—
O
O
O
O
O
34
–H
–OCH3
—
4.2.1. 5,7-Dihydroxy-2-(m-tolyl)-4H-chromen-4-one (1)
82% yield; 1H NMR (400 MHz, DMSO): d 10.95 (s, 1H), 10.90 (s,
1H), 7.71 (d, J = 8.2 Hz, 1H), 7.68 (s, 1H), 7.36 (t, J = 7.6 Hz, 1H), 7.22
(d, J = 7.1 Hz, 1H), 6.55 (s, 1H), 6.23 (d, J = 1.8 Hz, 1H), 6.08 (d,
J = 1.8 Hz, 1H), 2.36 (s, 3H); HRMS (ESI-TOF): m/z calcd for
[C16H12O4+H+]: 267.0657, found 267.0662.
O
F
35
36
–H
–H
–OCH3
–OCH3
—
—
F
37
38
–H
–H
–OCH3
–OCH3
—
—
CF3
N
4.2.2. 2-(4-Ethylphenyl)-5,7-dihydroxy-4H-chromen-4-one (2)
77% yield; 1H NMR (400 MHz, DMSO): d 10.96 (s, 1H), 10.92 (s,
1H), 7.81 (d, J = 8.1 Hz, 1H), 7.34 (dd, J = 21.0, 8.1 Hz, 2H), 7.19 (d,
J = 8.0 Hz, 1H), 6.59 (s, 1H), 6.22 (d, J = 1.7 Hz, 1H), 6.08 (d,
J = 1.7 Hz, 1H), 2.65 (m, 2H), 1.20 (t, 3H); HRMS (ESI-TOF): m/z
calcd for [C17H14O4+H+]: 283.0965, found 283.0967.
O
39
40
–H
–H
–OCH3
–OCH3
—
—
O
*
Concentration: 100 lM; ‘—‘: means no activity.
4.2.3. 2-(4-Ethoxyphenyl)-5,7-dihydroxy-4H-chromen-4-one (3)
73% yield; 1H NMR (400 MHz, DMSO): d 10.90 (s, 1H), 10.85 (s,
1H), 7.84 (d, J = 8.8 Hz, 2H), 7.02 (d, J = 8.8 Hz, 2H), 6.58 (s, 1H),
6.21 (d, J = 1.7 Hz, 1H), 6.07 (d, J = 1.7 Hz, 1H), 4.08 (q, J = 6.9 Hz,
2H), 1.34 (t, J = 7.0 Hz, 3H); HRMS (ESI-TOF): m/z calcd for
[C17H14O5+H+]: 297.0763, found 297.0761.
C7-OH may present a new class of QC inhibitors and flavonoids
should be investigated deeply for the treatment of AD and other
QC related diseases.
4. Materials and methods
4.1. General chemistry
4.2.4. 2-(2,4-Dimethoxyphenyl)-5,7-dihydroxy-4H-chromen-4-
one (4)
The 1H NMR (400 MHz) data was recorded on a Bruker Avance
III, using CDCl3 or DMSO-d6 as solvent. The high-resolution positive
ion mass spectra were obtained from a LCMS-IT-TOF (SHIMADZU).
Positive control PBD150 was synthesized according to the previous
report.32 Materials were purchased from Sigma–Aldrich Co., Ltd
and Sinopharm Chemical Reagent Co., Ltd. All other regents were
of analytical grade and commercial.
69% yield; the NMR and MS data of obtained compound is con-
sistent with the reported.33
4.2.5. 2-(2,3-Dimethoxyphenyl)-5,7-dihydroxy-4H-chromen-4-
one (5)
67% yield; the NMR and MS data of obtained compound is con-
sistent with the reported.34
4.2.6. 2-(2-Fluorophenyl)-5,7-dihydroxy-4H-chromen-4-one (6)
66% yield; the NMR and MS data of obtained compound is
consistent with the reported.35
4.2. General procedure for the preparation of compounds 1–40
Material I (1.0 equiv) and 2-chloroacetonitrile (1.5 equiv) were
mixed in Et2O filled with HCl gas. ZnCl2 (2.0 equiv) was added
and used as catalyst. The mixture was stirred at room temperature
until I was disappeared analyzed by TLC. Then the resulting precip-
itate (II) was filtered off and reserved. Material II was dissolved in
10% HCl/H2O solution, and the mixture was stirred at 60 °C for 10–
12 h. When the mixture was cooled to room temperature, the
resulting precipitate (III) was filtered off and reserved. Material
III (1.0 equiv) and IV (1.0 equiv) were dissolved in the H2O/EtOH
(1:5, V/V) solution containing 5% NaOH. The mixture was stirred
Table 4
IC50 values of selected apigenin derivatives*
Compd
IC50 ( SD, lM)
1
2
3
5
6
7
8
9
16.1 2.0
37.2 2.4
14.2 1.1
27.9 1.9
34.6 3.2
15.3 2.1
19.3 3.9
15.0 3.7
45.2 3.2
16.8 2.6
26.0 1.4
5.3 0.7
11
23
24
PBD150
**
*
IR P80% at 100 lM.
Positive control.
**
Figure 2. The structure–activity relationship of apigenin based hQC inhibitors.

2284
M. Li et al. / Bioorg. Med. Chem. 24 (2016) 2280–2286
Figure 3. Possible binding mode for compound 1 at the active site of hQC. Left: the capped stick mode. Right: a close-up view of molecular surface of the active site.
Compound 1 and some active site residues are colored yellow and green, respectively, and the zinc ions are shown as gray balls.
4.2.7. 5,7-Dihydroxy-2-(thiophen-2-yl)-4H-chromen-4-one (7)
80% yield; the NMR and MS data of obtained compound is con-
sistent with the reported.36
4.2.16. 2-(2,3-Dimethoxyphenyl)-7-hydroxy-4H-chromen-4-one
(16)
67% yield; 1H NMR (400 MHz, DMSO): d 11.24 (s, 1H), 7.80–7.75
(m, 1H), 7.63 (d, J = 8.4 Hz, 1H), 7.21 (t, J = 8.0 Hz, 1H), 7.15 (d,
J = 8.2 Hz, 1H), 6.96 (s, 1H), 6.78 (d, J = 1.8 Hz, 1H), 6.72 (dd,
J = 8.5, 1.9 Hz, 1H), 3.84 (s, 3H), 3.81 (s, 3H); HRMS (ESI-TOF): m/
z calcd for [C17H14O5+H+]: 297.0763, found 297.0773.
4.2.8. 5,7-Dihydroxy-2-(3-methylthiophen-2-yl)-4H-chromen-
4-one (8)
79% yield; 1H NMR (400 MHz, DMSO): d 10.95 (s, 1H), 10.88 (s,
1H), 7.75 (d, J = 5.1 Hz, 1H), 7.04 (d, J = 5.1 Hz, 1H), 6.83 (s, 1H),
6.17 (d, J = 1.7 Hz, 1H), 6.08 (d, J = 1.7 Hz, 1H), 2.37 (s, 3H); HRMS
(ESI-TOF): m/z calcd for [C14H10O4S+H+]: 273.0222, found
273.0234.
4.2.17. 7-Hydroxy-2-(3,4,5-trimethoxyphenyl)-4H-chromen-4-
one (17)
63% yield; the NMR and MS data of obtained compound is con-
sistent with the reported.41
4.2.9. 5,7-Dihydroxy-2-(5-methylthiophen-2-yl)-4H-chromen-
4-one (9)
4.2.18. 7-Hydroxy-2-(4-(methylthio)phenyl)-4H-chromen-4-one
(18)
78% yield; 1H NMR (400 MHz, DMSO): d 10.90 (s, 1H), 10.86 (s,
1H), 7.40 (d, J = 3.5 Hz, 1H), 6.90 (s, 1H), 6.89 (d, J = 2.8 Hz, 1H),
6.16 (d, J = 1.5 Hz, 1H), 6.06 (d, J = 1.5 Hz, 1H), 2.51 (s, 3H); HRMS
(ESI-TOF): m/z calcd for [C14H10O4S+H+]: 273.0222, found
273.0229.
81% yield; 1H NMR (400 MHz, DMSO): d 7.89 (d, J = 8.5 Hz, 2H),
7.62 (d, J = 8.4 Hz, 1H), 7.36 (d, J = 8.6 Hz, 2H), 6.78 (d, J = 1.9 Hz,
1H), 6.77 (s, 1H), 6.71 (dd, J = 8.4, 2.0 Hz, 1H), 2.53 (s, 3H); HRMS
(ESI-TOF): m/z calcd for [C16H12O3S+H+]: 283.0429, found 283.0422.
4.2.19. 2-(4-Fluorophenyl)-7-hydroxy-4H-chromen-4-one (19)
78% yield; the NMR and MS data of obtained compound is con-
sistent with the reported.42
4.2.10. 2-(4-Ethylphenyl)-7-hydroxy-4H-chromen-4-one (10)
78% yield; the NMR and MS data of obtained compound is con-
sistent with the reported.37
4.2.20. 2-(3-Fluorophenyl)-7-hydroxy-4H-chromen-4-one (20)
77% yield; 1H NMR (400 MHz, DMSO): d 7.78 (dd, J = 11.2,
4.6 Hz, 2H), 7.64 (d, J = 8.5 Hz, 1H), 7.54 (td, J = 8.2, 6.2 Hz, 1H),
7.28 (td, J = 8.2, 2.2 Hz, 1H), 6.84 (d, J = 1.9 Hz, 1H), 6.82 (s, 1H),
6.74 (dd, J = 8.5, 2.0 Hz, 1H); HRMS (ESI-TOF): m/z calcd for
[C15H9O3F+H+]: 255.0457, found 255.0464.
4.2.11. 7-Hydroxy-2-(4-hydroxyphenyl)-4H-chromen-4-one (11)
75% yield; the NMR and MS data of obtained compound is con-
sistent with the reported.38
4.2.12. 7-Hydroxy-2-(4-methoxyphenyl)-4H-chromen-4-one
(12)
4.2.21. 2-(2-Fluorophenyl)-7-hydroxy-4H-chromen-4-one (21)
63% yield; the NMR and MS data of obtained compound is con-
sistent with the reported.43
76% yield; the NMR and MS data of obtained compound is con-
sistent with the reported.38
4.2.13. 2-(4-Ethoxyphenyl)-7-hydroxy-4H-chromen-4-one (13)
75% yield; the NMR and MS data of obtained compound is con-
sistent with the reported.39
4.2.22. 7-Hydroxy-2-(2-(trifluoromethyl)phenyl)-4H-chromen-
4-one (22)
71% yield; 1H NMR (400 MHz, DMSO): d 11.39 (s, 1H), 8.36 (d,
J = 7.9 Hz, 1H), 7.86 (dd, J = 14.6, 7.9 Hz, 2H), 7.68 (d, J = 8.5 Hz,
1H), 7.64 (t, J = 7.7 Hz, 1H), 6.83–6.79 (m, 2H), 6.75 (d, J = 2.0 Hz,
1H); HRMS (ESI-TOF): m/z calcd for [C16H9O3F3+H+]: 305.0426,
found 305.0439.
4.2.14. 7-Hydroxy-2-(2-methoxyphenyl)-4H-chromen-4-one
(14)
69% yield; the NMR and MS data of obtained compound is con-
sistent with the reported.40
4.2.23. 2-(4-(Dimethylamino)phenyl)-7-hydroxy-4H-chromen-
4-one (23)
4.2.15. 2-(3,4-Dimethoxyphenyl)-7-hydroxy-4H-chromen-4-one
(15)
64% yield; the NMR and MS data of obtained compound is
71% yield; the NMR and MS data of obtained compound is con-
consistent with the reported.37
sistent with the reported.41

M. Li et al. / Bioorg. Med. Chem. 24 (2016) 2280–2286
2285
4.2.24. 7-Hydroxy-2-(pyridin-4-yl)-4H-chromen-4-one (24)
72% yield; the NMR and MS data of obtained compound is con-
sistent with the reported.44
4.2.36. 2-(3-Fluorophenyl)-7-methoxy-4H-chromen-4-one (36)
97% yield; the NMR and MS data of obtained compound is con-
sistent with the reported.50
4.2.37. 7-Methoxy-2-(2-(trifluoromethyl)phenyl)-4H-chromen-
4-one (37)
4.2.25. 7-Hydroxy-2-(pyridin-3-yl)-4H-chromen-4-one (25)
71% yield; the NMR and MS data of obtained compound is con-
sistent with the reported.39
91% yield; 1H NMR (400 MHz, CDCl3): d 8.35 (d, J = 8.0 Hz, 1H),
7.74 (dd, J = 8.1, 5.7 Hz, 2H), 7.65 (dd, J = 12.5, 4.8 Hz, 1H), 7.47 (t,
J = 7.7 Hz, 1H), 7.12 (d, J = 1.7 Hz, 1H), 6.78 (dd, J = 8.5, 2.1 Hz, 1H),
6.75 (d, J = 2.0 Hz, 1H), 3.93 (s,3H); HRMS (ESI-TOF): m/z calcd for
[C17H11O3F3+H+]: 321.0739, found321.0742.
4.2.26. 7-Hydroxy-2-(pyridin-2-yl)-4H-chromen-4-one (26)
71% yield; 1H NMR (400 MHz, DMSO): d 8.70 (d, J = 4.0 Hz, 1H),
8.16 (d, J = 7.9 Hz, 1H), 7.94 (dd, J = 10.8, 4.6 Hz, 1H),
7.65 (d, J = 8.5 Hz, 1H), 7.40 (dd, J = 7.0, 5.3 Hz, 1H), 6.78 (d,
J = 1.7 Hz, 1H), 6.71 (dd, J = 8.5, 1.8 Hz, 1H), 6.67 (s, 1H);
HRMS (ESI-TOF): m/z calcd for [C14H9NO3+H+]: 240.0655, found
240.0658.
4.2.38. 7-Methoxy-2-(pyridin-3-yl)-4H-chromen-4-one (38)
93% yield; the NMR and MS data of obtained compound is con-
sistent with the reported.51
4.2.39. 2-(Furan-2-yl)-7-methoxy-4H-chromen-4-one (39)
95% yield; the NMR and MS data of obtained compound is con-
sistent with the reported.52
4.2.27. 2-(Furan-2-yl)-7-hydroxy-4H-chromen-4-one (27)
75% yield; the NMR and MS data of obtained compound is con-
sistent with the reported.45
4.2.40. 2-(Furan-3-yl)-7-methoxy-4H-chromen-4-one (40)
97% yield; 1H NMR (400 MHz, DMSO): d 8.29(s, 1H), 7.87 (s, 1H)
7.67 (d, J = 8.6 Hz, 1H), 7.12 (d, J = 1.9 Hz, 1H), 7.03 (s, 1H), 6.88–
6.82 (m, 2H), 3.93 (s, 1H); HRMS (ESI-TOF): m/z calcd for
[C14H10O4+H+]: 243.0652, found 243.0654.
4.2.28. 2-(Furan-3-yl)-7-hydroxy-4H-chromen-4-one (28)
78% yield; 1H NMR (400 MHz, DMSO): d 11.19 (s, 1H), 8.27(s,
1H), 7.84(s, 1H), 7.60 (d, J = 8.5 Hz, 1H), 7.01 (d, J = 1.6 Hz, 1H),
6.79 (d, J = 2.0 Hz, 2H), 6.71 (dd, J = 8.4, 1.9 Hz, 1H); HRMS (ESI-
TOF): m/z calcd for [C13H8O4+H+]: 229.0495, found 229.0494.
4.3. In vitro inhibition studies on hQC
4.2.29. 7-Hydroxy-2-(5-methylfuran-2-yl)-4H-chromen-4-one
(29)
4.3.1. Preparation of hQC
73% yield; 1H NMR (400 MHz, DMSO): d 7.56 (d, J = 9.2 Hz, 1H),
7.09 (s, 1H), 7.01 (d, J = 3.4 Hz, 1H), 6.39 (d, J = 3.4 Hz, 1H), 6.21 (dd,
J = 9.2, 1.4 Hz, 1H), 5.98 (s, 1H), 2.37 (s, 3H); HRMS (ESI-TOF): m/z
calcd for [C14H10O4+H+]: 241.0501, found 241.0511.
Cloning, expression and large scale preparation of hQC were
performed according to the previously reports.28–30 Generally,
the gene of hQC was inserted via the BamHI and XhoI restriction
sites into Escherichia coli expression vector pET32a (Invitrogen)
with additionally introduction of an N-terminal His6-tag (primer
pair Cs/Cas). Primers, 5-3: ACCTGGATCCGCTTCTGCTTGGCCGG,
BamHI; 5-3: TATCCTCGAGTTACAGGTGCAGGTATTC, XhoI (Takara).
4.2.30. 7-Methoxy-2-(3-methylthiophen-2-yl)-4H-chromen-4-
one (30)
E. coli strain DH5a was used for all cloning procedures. The cDNA
95% yield; 1H NMR (400 MHz, CDCl3): d 7.70 (d, J = 8.5 Hz, 1H),
7.52 (d, J = 5.1 Hz, 1H), 7.17 (d, J = 0.7 Hz, 1H), 6.95 (d, J = 5.1 Hz,
1H), 6.79 (d, J = 2.0 Hz, 1H), 6.76 (dd, J = 8.6, 2.1 Hz, 1H), 3.93 (s,
3H), 2.44 (s, 3H); HRMS (ESI-TOF): m/z calcd for [C15H12O3S+H+]:
273.0585, found 273.0582.
was verified by sequencing (Samgon). Plasmid DNA was amplified,
purified, and linearized. hQC was heterologously expressed in E.
coli BL21(DE3) using Fernbach flasks at room temperature over-
night and expression induced by addition of 0.2 mM IPTG (iso-
propyl b-D-1-thiogalactopyranoside). Cells were disrupted with
1 mg/mL lysozyme and a freeze-thaw cycle. The purification of
hQC protein followed two chromatographic steps: Ni2+-IMAC
(immobilized metal affinity chromatography), and molecular sieve
chromatography. QC-containing fractions were pooled and purity
was analyzed by SDS–PAGE (15%, sodium dodecyl sulfate polyacry-
lamide gel electrophoresis) and Coomassie Blue staining. The puri-
fied hQC enzyme was stored at ꢀ80 °C without glycerol.
4.2.31. 7-Methoxy-2-(4-methoxyphenyl)-4H-chromen-4-one
(31)
96% yield; the NMR and MS data of obtained compound is con-
sistent with the reported.46
4.2.32. 7-Methoxy-2-(2-methoxyphenyl)-4H-chromen-4-one
(32)
94% yield; the NMR and MS data of obtained compound is con-
4.3.2. hQC inhibition studies
sistent with the reported.47
The hQC activity was assayed essentially by spectrophotometric
assessment as described elsewhere.31 Briefly, the assay reactions
4.2.33. 2-(3,4-Dimethoxyphenyl)-7-methoxy-4H-chromen-4-
one (33)
(200
prepared H-Gln-Gln-H, 30 units/ml glutamic acid dehydrogenase,
0.5 mM NADH/H+, and 15 mM
-ketoglutaric acid in 0.05 M Tris–
lL) consisted of varying concentrations (0–4 mM) of freshly
97% yield; the NMR and MS data of obtained compound is con-
a
sistent with the reported.47
HCl, pH 8.0. Reactions were started by the addition of hQC and
were monitored by recording the decrease in absorbance at
340 nm for 15 min. In the screening, the assay reaction composi-
tion was the same as described above, except for the addition of
different concentrations of the apigenin derivatives in the solution
of hQC. The inhibition rate (IR) was calculated according to the for-
mula: IR (%) = (Vc ꢀ Vs)/Vc, Vc means the reaction velocity of con-
trol, Vs means the reaction velocity of samples. The IC50 values
were determined graphically from log concentration versus % of
inhibition curves. All experiments were performed in triplicate.
4.2.34. 7-Methoxy-2-(3,4,5-trimethoxyphenyl)-4H-chromen-4-
one (34)
95% yield; the NMR and MS data of obtained compound is con-
sistent with the reported.48
4.2.35. 2-(4-Fluorophenyl)-7-methoxy-4H-chromen-4-one (35)
97% yield; the NMR and MS data of obtained compound is con-
sistent with the reported.49

2286
M. Li et al. / Bioorg. Med. Chem. 24 (2016) 2280–2286
15. Tran, P. T.; Hoang, V. H.; Thorat, S. A.; Kim, S. E.; Ann, J.; Chang, Y. J.; Nam, D.
4.3.3. Statistical analysis
The results are expressed as the mean SD of at least three
independent experiments.
W.; Song, H.; Mook-Jung, I.; Lee, J.; Lee, J. Bioorg. Med. Chem. 2013, 21, 3821.
16. Pietta, P. G. J. Nat. Prod. 2000, 1035, 63.
17. Cho, J. G.; Song, N. Y.; Nam, T. G.; Shrestha, S.; Park, H. J.; Lyu, H. N.; Kim, D. O.;
Lee, G.; Woo, Y. M.; Jeong, T. S.; Baek, N. I. J. Agric. Food Chem. 2013, 61, 10354.
18. Nijveldt, R. J.; van Nood, E.; van Hoorn, D. E.; Boelens, P. G.; van Norren, K.; van
Leeuwen, P. A. Am. J. Clin. Nutr. 2001, 74, 418.
4.4. Molecular docking study
19. Thilakarathna, S. H.; Rupasinghe, H. P. Nutrients 2013, 5, 3367.
20. Beking, K.; Vieira, A. Public Health Nutr. 2010, 13, 1403.
21. Letenneur, L.; Proust-Lima, C.; Le Gouge, A.; Dartigues, J. F.; Barberger-Gateau,
P. Am. J. Epidemiol. 2007, 165, 1364.
22. Khan, M. T.; Orhan, I.; Senol, F. S.; Kartal, M.; Sener, B.; Dvorská, M.; Smejkal, K.;
Slapetová, T. Chem. Biol. Interact. 2009, 181, 383.
23. DeToma, A. S.; Krishnamoorthy, J.; Nam, Y.; Lee, H. J.; Brender, J. R.; Kochi, A.;
Lee, D.; Onnis, V.; Congiu, C.; Manfredini, S.; Vertuani, S.; Balboni, G.;
Ramamoorthy, A.; Lim, M. H. Chem. Sci. 2014, 5, 4851.
24. Cabrera, M.; Simoens, M.; Falchi, G.; Lavaggi, M. L.; Piro, O. E.; Castellano, E. E.;
Vidal, A.; Azqueta, A.; Monge, A.; de Ceráin, A. L.; Sagrera, G.; Seoane, G.;
Cerecetto, H.; González, M. Bioorg. Med. Chem. 2007, 15, 3356.
25. Baker, W. J. Chem. Soc. 1933, 1381.
Crystal structures of hQC with PDB code 2AFX were used for
docking study. The Molecular Operating Environment (MOE, vers.
2011.10, Chemical Computing Group, Montreal, Canada) and GOLD
(vers. 5.0, CCDC Software Ltd, Cambridge, U.K.) were used to com-
pute the ligand–protein interactions. The cocrystallized 1-ben-
zylimidazole was removed from the system. The active site was
defined using the zinc ion as the center.
Acknowledgements
26. Mahal, H. S.; Venkataraman, K. J. Chem. Soc. 1934, 1767.
27. Schilling, S.; Manhart, S.; Hoffmann, T.; Ludwig, H. H.; Wasternack, C.; Demuth,
H. U. Biol. Chem. 2003, 384, 1583.
28. Koch, B.; Buchholz, M.; Wermann, M.; Heiser, U.; Schilling, S.; Demuth, H. U.
Chem. Biol. Drug Des. 2012, 80, 937.
This work was supported by the grants of National Natural
Science Foundation of China (No. 81573288) and the Science and
Technology Planning Project of Guangdong Province (No.
2013B021100022).
29. Schilling, S.; Hoffmann, T.; Rosche, F.; Manhart, S.; Wasternack, C.; Demuth, H.
U. Biochemistry 2002, 41, 10849.
30. Ruiz-Carrillo, D.; Koch, B.; Parthier, C.; Wermann, M.; Dambe, T.; Buchholz, M.;
Ludwig, H. H.; Heiser, U.; Rahfeld, J. U.; Stubbs, M. T.; Schilling, S.; Demuth, H.
U. Biochemistry 2011, 50, 6280.
Supplementary data
31. Schilling, S.; Niestroj, A. J.; Rahfeld, J. U.; Hoffmann, T.; Wermann, M.; Zunkel,
K.; Wasternack, C.; Demuth, H. U. J. Biol. Chem. 2003, 278, 49773.
32. Brooks, A. F.; Jackson, I. M.; Shao, X.; Kropog, G. W.; Sherman, P.; Quesada, C. A.;
Scott, P. J. MedChemComm 2015, 1065, 6.
Supplementary data associated with this article can be found, in
the online version, at http://dx.doi.org/10.1016/j.bmc.2016.03.064.
33. Robert, R.; Krishnasami, V. J. Chem. Soc. 1929, 61.
References and notes
34. Elliger, C. A.; Henika, P. R.; MacGregor, J. T. Mutat. Res. 1984, 135, 77.
35. Katsuyama, Y.; Funa, N.; Miyahisa, I.; Horinouchi, S. Chem. Biol. 2007, 14, 613.
36. Chang, L. S.; Li, C. B.; Qin, N.; Jin, M. N.; Duan, H. Q. Chem. Biodivers. 2012, 9, 162.
37. Costantino, L.; Rastelli, G.; Albasini, A. Eur. J. Med. Chem. 1996, 31, 693.
38. Murti, Y.; Goswami, A.; Mishra, P. Inter. J. PharmTech. Res. 2013, 5, 811.
39. Pacheco, H. Bulletin de la Societe Chimique de France. 1960, 95.
40. Laget, M.; De Meo, M.; Wallet, J. C.; Gaydou, E. M.; Guiraud, H.; Dumenil, G.
Arch. Pharm. Res. 1995, 18, 415.
41. Verma, A. K.; Singh, H.; Satyanarayana, M.; Srivastava, S. P.; Tiwari, P.; Singh, A.
B.; Dwivedi, A. K.; Singh, S. K.; Srivastava, M.; Nath, C.; Raghubir, R.; Srivastava,
A. K.; Pratap, R. J. Med. Chem. 2012, 55, 4551.
42. Phosrithong, N.; Ungwitayatorn, J. Bioorg. Chem. 2013, 49, 9.
43. Liu, X.; Yu, X.; Hong, X.; Zhi, H.; Huang, E.; Hu, C. Zhongguo Yaowu Huaxue Zazhi
2009, 19, 340.
44. Jackson, S. P.; Robertson, A. D.; Kenche, V.; Thompson, P.; Prabaharan, H.;
Anderson, K.; Abbott, B.; Goncalves, I.; Nesbitt, W.; Schoenwaelder, S.; Saylik,
D. PCT Int. Appl. 2004. WO2004016607.
45. Lefloch, Y.; LeFeuvre, M. Tetrahedron Lett. 1986, 27, 2751.
46. Thorat, N. M.; Kote, S. R.; Thopate, S. R. Lett. Org. Chem. 2014, 11, 601.
47. Lee, S.; Moon, B. H.; Park, Y.; Lee, E.; Hong, S.; Lim, Yo Bull. Korean Chem. Soc.
2008, 29, 1793.
48. Yoshida, M.; Fujino, Y.; Saito, K.; Doi, T. Tetrahedron 2011, 67, 9993.
49. Abdel Ghani, S. B.; Mugisha, P. J.; Wilcox, J. C.; Gado, E. A. M.; Medu, E. O.; Lamb,
A. J.; Brown, R. C. D. Synth. Commun. 2013, 43, 1549.
50. Bobach, C.; Tennstedt, S.; Palberg, K.; Denkert, A.; Brandt, W.; de Meijere, A.;
Seliger, B.; Wessjohann, L. A. Eur. J. Med. Chem. 2015, 90, 267.
51. Ismail, K. A.; Abd, E. I.; Aziem, T. Eur. J. Med. Chem. 2001, 36, 243.
52. Devitt, P. F.; Timoney, A.; Vickars, M. A. J. Org. Chem. 1961, 26, 4941.
1. Busby, W. H., Jr.; Quackenbush, G. E.; Humm, J.; Youngblood, W. W.; Kizer, J. S. J.
Biol. Chem. 1987, 262, 8532.
2. Gontsarova, A.; Kaufmann, E.; Tumani, H.; Dressel, A.; Mandel, F.; Wiesmüller,
K. H.; Kunert-Keil, C.; Brinkmeier, H. Clin. Chim. Acta 2008, 389, 152.
3. Holtzman, D. M.; Morris, J. C.; Goate, A. M. Sci. Transl. Med. 2011, 3, 77sr1.
4. Mangialasche, F.; Solomon, A.; Winblad, B.; Mecocci, P.; Kivipelto, M. Lancet
Neurol. 2010, 9, 702.
5. Blennow, K.; de Leon, M. J.; Zetterberg, H. Lancet 2006, 368, 387.
6. Schilling, S.; Lauber, T.; Schaupp, M.; Manhart, S.; Scheel, E.; Böhm, G.; Demuth,
H. U. Biochemistry 2006, 45, 12393.
7. Schlenzig, D.; Manhart, S.; Cinar, Y.; Kleinschmidt, M.; Hause, G.; Willbold, D.;
Funke, S. A.; Schilling, S.; Demuth, H. U. Biochemistry 2009, 48, 7072.
8. Jawhar, S.; Wirths, O.; Bayer, T. A. J. Biol. Chem. 2011, 286, 38825.
9. Schilling, S.; Zeitschel, U.; Hoffmann, T.; Heiser, U.; Francke, M.; Kehlen, A.;
Holzer, M.; Hutter-Paier, B.; Prokesch, M.; Windisch, M.; Jagla, W.; Schlenzig,
D.; Lindner, C.; Rudolph, T.; Reuter, G.; Cynis, H.; Montag, D.; Demuth, H. U.;
Rossner, S. Nat. Med. 2008, 14, 1106.
10. Miravalle, L.; Calero, M.; Takao, M.; Roher, A. E.; Ghetti, B.; Vidal, R.
Biochemistry 2005, 44, 10810.
11. Schilling, S.; Appl, T.; Hoffmann, T.; Cynis, H.; Schulz, K.; Jagla, W.; Friedrich, D.;
Wermann, M.; Buchholz, M.; Heiser, U.; von Hörsten, S.; Demuth, H. U. J.
Neurochem. 2008, 106, 1225.
12. Lues, I.; Weber, F.; Meyer, A.; Bühring, U.; Hoffmann, T.; Kühn-Wache, K.;
Manhart, S.; Heiser, U.; Pokorny, R.; Chiesa, J.; Glund, K. Alzheimer’s Dementia:
Transl. Res. Clin. Interventions 2015, 1, 182.
13. Buchholz, M.; Heiser, U.; Schilling, S.; Niestroj, A. J.; Zunkel, K.; Demuth, H. U. J.
Med. Chem. 2006, 49, 664.
14. Ramsbeck, D.; Buchholz, M.; Koch, B.; Böhme, L.; Hoffmann, T.; Demuth, H. U.;
Heiser, U. J. Med. Chem. 2013, 56, 6613.