C O M M U N I C A T I O N S
will stabilize the dithio function even further. Such a group is also
expected to drastically limit the unpleasant odor of the mercaptan,
otherwise necessitating that oligonucleotide deprotection is per-
formed in a fumehood. All amidites, when activated by 5-ethylthio-
1-H-tetrazole (ETT), coupled within 150 s with efficiencies ranging
from 98.5 to 99.8%, which is well comparable with other best-
performing RNA amidites. Concentrated (0.1 M) solutions of iodine
partially cleaved the S-S bond as was found in experiments using
both 2′-O-DTM-protected nucleosides and DTM-protected RNA
dimers. Surprisingly, the diluted (0.02 M) solution did not give
rise to detectable DTM degradation. This peculiar behavior of dilute
iodine was recently also reported by others.11 The synthesized
oligonucleotides were deprotected and cleaved from the synthesis
support using aqueous concentrated ammonia at 55 °C after
previously proving that such conditions are completely inert for
the DTM function. The removal of the 2′-OH protecting group was
performed after evaporation of ammonia and dissolution of the
residual and otherwise stable material in a buffered (pH 7.6) solution
containing 1,4-dithiothreitol (DTT) or tris(2-carboxyethyl)phosphine
(TCEP) at 55 °C. These homogeneous, aqueous, and nearly neutral
conditions ensured complete removal of all 2′-OH protecting groups
without any risk of internucleotide bond cleavage or isomerization.
The DTM group removal consists of two steps, and at this pH the
initial step of the S-S bond reduction proceeds very fast. The
liberated thiohemiformacetal eliminates a molecule of thioforma-
dehyde, yielding the free 2′-OH function. The thiohemiformacetal
group was unusually stable at lower pH, compared to the stability
of hemiformacetals under the same conditions, suggesting the
possibility of using this function as a target for RNA labeling. It
breaks down much faster at higher temperature and higher pH
conditions. Thus, DTM removal from an A(2′-O-DTM)pC at 20 °C
gave t∞ 1200 and 120 min for reactions performed at pH 6.8 and
8.0, respectively. Increasing the temperature to 55 °C speeds this
process further (t∞ ≈ 7 min). For deprotection of longer sequences,
as the amount of reducing agent per DTM group decreases, we
have used a prolonged time of 90 min at 55 °C. The acid labile
5′-O-DMTr group was completely stable under the above depro-
tection conditions. Thus tritylated oligonucleotides can be easily
purified by reversed phase HPLC chromatography. Moreover, as
the oligonucleotide solution neither contains any organic solvent
nor any other substances deteriorating the chromatographic columns,
no prior desalting step is necessary.
We prefer, however, to perform this separation using a cartridge
system and a novel on-cartridge detritylation methodology,12
allowing for parallel separation of hundreds of oligonucleotides.
The digestion of the purified products using nuclease P1 followed
by alkaline phosphatase13 resulted in the conversion to four
nucleosides only, proving the absence of any unnatural phosphodi-
ester linkages or modified bases.
The biological function of RNA synthesized by the DTM
methodology was confirmed by: (i) analyzing the rate of RNase P
RNA-mediated cleavage of a model RNA substrate14 synthesized
by the DTM and ACE procedures, respectively (Figure 1a, b, and
c), and (ii) a fast and complete digestion of RNA/DNA hybrid upon
treatment by RNase H (Figure 1d).
The 2′-O-DTM protection was found to be fully orthogonal to
the existing silyl-based 2′-OH protecting groups. It was thus possible
to perform RNA synthesis, using both types of building blocks
simultaneously, and to incorporate them in any desired order and
proportion. Selective cleavage of the silyl protecting groups resulted
in RNA protected only by the 2′-O-DTM groups. For example,
performing RNA synthesis using 2′-O-silyl-protected phosphor-
amidites on a 2′-O-DTM-protected nucleoside support results in
Figure 1. Identity and purity of RNA synthesized according to the DTM
method. (a) Analysis of the 45-mer (5′GAUCUGAAUGGAGAGAGG
GGGUUCAAAUCCCCCUCUCUCCGCCAC) model RNase P RNA sub-
stratre made by the DTM method (1) and purchased from Dharmacon (2),
made by the ACE method. (b) Single-turnover measurement of the cleavage
efficiency with RNase P RNA. Both RNA molecules are cleaved at the
same rate. (c) Identical migration of the 5′ cleavage products. (d) RNase H
digestion of a 22-mer RNA/DNA duplex (5′GAUCUGAAUGUUCAAA-
UGCCAC). Control ) RNA + RNase H; +DNA ) RNA + complementary
DNA + RNase H. The data points correspond to 40 s, 2 and 10 min,
respectively.
RNA containing a 3′-terminal nucleoside bearing a single DTM
function. A closely related 2′-S-S-nBu-substituted RNA derivative
was recently reported to undergo spontaneous and site-specific
aminoacylation with activated amino acid thioesters.15 This interest-
ing process is disturbed by a tendency for formation of bis-acylated
products, and by the presence of the 2′-SH function in the final
material. We are investigating if these drawbacks could be omitted
by using the present 2′-O-DTM strategy.
Moreover, during incubation of 2′-O-DTM-protected oligonucleo-
tides with serum we found that the DTM function is biodegradable
(data not shown); hence, in in vivo experiments complete depro-
tection of RNA may not be necessary.
Acknowledgment. We acknowledge Dr. Ulf Landegren for
helpful scientific discussions and Dr. Johan Nilsson for assistance
in large-scale phosphoramidite synthesis.
Supporting Information Available: Experimental procedures and
characterization of all new compounds; studies of amidite stabilities
and kinetics of RNA deprotection and enzymatic digest. This material
References
(1) Pitsch, S.; Weiss, P. A.; Jenny, L.; Stutz, A.; Wu, X. HelV. Chim. Acta
2001, 84, 3773-3795.
(2) Wincott, F.; DiRenzo, A.; Shaffer, C.; Grimm, S.; Tracz, D.; Workman,
C.; Sweedler, D.; Gonzalez, C.; Scaringe, S.; Usman, N. Nucleic Acids
Res. 1995, 23, 2677-2684.
(3) Scaringe, S. A.; Wincott, F. E.; Caruthers, M. H. J. Am. Chem. Soc. 1998,
120, 11820-11821.
(4) Ohgi, T.; Masutomi, Y.; Ishiyama, K.; Kitagawa, H.; Shiba, Y.; Yano, J.
Org. Lett. 2005, 7, 3477-3480.
(5) Sandstrom, A.; Kwiatkowski, M.; Chattopadhyaya, J.-B. Acta Chem.
Scand. [b] 1985, 39, 273-290.
(6) Zavgorodny, S. G.; Pechenov, A. E.; Shvets, V. I.; Miroshnikov, A. I.
Nucleosides Nucleotides Nucleic Acids 2000, 19, 1977-1991.
(7) Vu, H.; Hirschbein, B. L. Tetrahedron Lett. 1991, 32, 3005-3008.
(8) Xu, Q. H.; MusierForsyth, K.; Hammer, R. P.; Barany, G. Nucleic Acids
Res. 1996, 24, 1602-1607.
(9) Goodwin, J. T.; Osborne, S. E.; Scholle, E. J.; Glick, G. D. J. Am. Chem.
Soc. 1996, 118, 5207-5215.
(10) Kamimura, T.; Tsuchiya, M.; Koura, K.; Sekine, M.; Hata, T. Tetrahedron
Lett. 1983, 24, 2775-2778.
(11) Okamoto, I.; Seio, K.; Sekine, M. Tetrahedron Lett. 2006, 47, 583-585.
(12) Semenyuk, A.; Ahnfelt, M.; Estmer-Nilsson, C.; Hao, X.-Y.; Fo¨ldesi, A.;
Kao, Y.-S.; Chen, H.-H.; Kao, W.-C.; Peck, K.; Kwiatkowski, M. Anal.
Biochem. 2006, 356, 132-141.
(13) Gehrke, C. W.; Kuo, K. C. J. Chromatogr. 1989, 471, 3-36.
(14) Kufel, J.; Kirsebom, L. A. RNA 1998, 4, 777-788.
(15) Porcher, S.; Meyyappan, M.; Pitsch, S. HelV. Chim. Acta 2005, 88,
2897-2909.
JA0636587
9
J. AM. CHEM. SOC. VOL. 128, NO. 38, 2006 12357