Structure−Function Relationships of DHNA
A R T I C L E S
µM SaY54F was titrated with a stock solution of 8 or 9. To determine
the Kd values of the binding of 10 to SaY54F and the binding of 8, 9,
and 10 to EcY53F, a 2 mL solution containing 1 µM of one of the
ligands (8, 9, or 10) was titrated with a stock solution of SaY54F or
EcY53F. The Kd values were obtained by nonlinear least-squares fitting
of the titration data as previously described.9
Stopped-Flow Analysis. Stopped-flow experiments were performed
on an Applied Photophysics SX.18MV-R stopped-flow spectrofluo-
rometer at 25 °C. One syringe contained the protein (SaY54F or
EcY53F), and the other contained 8, 9, or 10. The protein concentration
was 1 or 2 µM, and the ligand concentrations ranged from 5 to 60 µM.
All concentrations reported are those after the mixing of the two syringe
solutions. Fluorescence traces were obtained with an excitation
wavelength of 360 nm and a filter with a cutoff of 395 nm for emission.
Apparent rate constants were obtained by nonlinear least-squares fitting
of the data to a single-exponential equation and were replotted against
the ligand concentrations. The association and dissociation constants
were obtained by linear regression of the apparent rate constants vs
ligand concentration data.
Kinetic Assay. The kinetic experiments were performed manually.
Both 1 and DHNA were dissolved in a buffer containing 100 mM Tris-
HCl, 1 mM ethylenediaminetetraacetic acid, and 5 mM dithiothreitol,
pH 8.3. The reactions were initiated by the addition of DHNA and
stopped with 1 N HCl. The stopped reaction mixtures were processed
and separated by HPLC as previously described.6
NMR Spectroscopy. NMR measurements were made at 25 °C with
a Varian Inova 600 spectrometer. The initial NMR sample contained
1 mM 1 and 1 mM tris(2-carboxyethyl) phosphine (TCEP) in 100 mM
sodium phosphate buffer, pH 8.3 (pH meter reading without correction
for deuterium isotope effects), made with 90% H2O and 10% D2O.
The reaction was initiated with 1 µM SaDHNA or 3 µM SaY54F. NMR
spectra were recorded before and after the addition of the enzyme. The
spectral width for the NMR data was 12000 Hz, with the carrier
frequency at the HDO resonance. The solvent resonance was suppressed
by presaturation. Each FID was composed of 16K data points with 64
transients. The delay between successive transients was 1.7 s. The time
domain data were processed by zero-filling to 32K points, exponential
multiplication (1 Hz), and Fourier transformation. Chemical shifts were
referenced to the internal standard sodium 2-dimethyl-2-silapentane-
5-sulfonate sodium salt.
Mass Spectrometry (MS). All MS experiments were performed
using a Thermo model LTQ linear ion trap mass spectrometer. The
initial 300 µL samples contained 200 µM 1 and 4 µM SaDHNA or 10
µM SaY54F in 5 mM ammonium carbonate, pH 8. Twenty-microliter
aliquots of the reaction mixtures were taken out at 1-min intervals and
mixed with 80 µL of a solution containing 1% acetic acid and 50%
methanol. The samples were further diluted with the same solution and
then introduced into the mass spectrometer at a flow rate of 0.5 µL/
min by nanoelectrospray ionization (nESI). The following nESI
conditions were used: spray voltage, 1.8 kV; heated capillary temper-
ature, 200 °C; capillary voltage, -10 V; and tube lens voltage, -50
V. Collision-induced dissociation (CID) tandem mass spectrometry
(MS/MS and MS3) spectra were acquired at an activation q value of
0.25 using an isolation width of 1 or 2 Da (to monoisotopically isolate
the precursor ion), a normalized collision energy of 30-40%, and an
activation time of 30 or 300 ms. The values were chosen such that the
gentlest conditions were used in order to completely dissociate the
selected precursor ion (i.e., some precursor ions required a larger
normalized collision energy and/or longer activation time). The MS,
MS/MS, and MS3 product ion spectra shown are the averages of 60
individual mass analysis scans.
Figure 2. Polar interactions of 4 with SaDHNA.
4. 6 is generated via the same enol intermediate (2) as in the
wild-type enzyme-catalyzed reaction, but this species undergoes
an oxygenation reaction to form 6. The conserved tyrosine
residue plays only a minor role in the formation of the enol
reaction intermediate but a critical role in the protonation of
the enol intermediate to form 4.
Experimental Procedures
Materials. Compounds 1, 4, 5, 6, 7 (6-formyl-7,8-dihydropterin), 8
(D-neopterin), 9 (L-monapterin), and 10 (6-hydroxymethylpterin) were
purchased from Schircks Laboratories. Other chemicals were from
Sigma or Aldrich. Pfu DNA polymerase was purchased from Strategene.
Other molecular biology reagents were from New England Biolab.
Site-Directed Mutagenesis and Protein Purification. The mutants
SaY54F and EcY53F, where Y54 of SaDHNA and Y53 of EcDHNA
were replaced by a phenylalanine residue, respectively, were made by
a polymerase chain reaction-based method using high-fidelity pfu DNA
polymerase according to a protocol developed by Stratagene. The
forward and reverse primers for making the SaY54F mutant were 5′-
GTT ATTGATACAGTTCATTTTGGTGAAGTGTTCGAAGAG G-3′
and 5′-CCTCTTCGAACA CTTCACCAAAATGAACTGTATCAA-
TAAC-3, respectively. The forward and reverse primers for making
the EcY53F mutant were 5′-CGGATTGCCTCAGTTTCGCTGACAT-
TGCAGAAAC-3′ and 5′-GTTTCTGCAATGTCAGCGAAACTGAG-
GCAATCCG-3′, respectively. The mutants were selected by DNA
sequencing. To ensure that there were no unintended mutations in the
mutants, the entire coding sequences of the mutated genes were
determined.
The mutant proteins were purified as previously described (Wang
et al., unpublished). Briefly, SaY5F was purified to homogeneity by a
Ni-NTA column followed by a Bio-Gel A-0.5m gel column (Bio-Rad).
EcY53F was purified by a (diethylamino)ethyl-cellulose column
(Whatman) followed by a Bio-Gel A-0.5m gel column. The purities of
the protein preparations were checked by sodium dodecyl sulfate-
polyacrylamide gel electrophoresis. The amino acid sequences of the
purified proteins were confirmed by “top-down” tandem mass spec-
trometry.8 The purified proteins were concentrated, dialyzed, lyophi-
lized, and stored at -80 °C.
Equilibrium Binding Studies. The procedures for the equilibrium
binding studies of DHNAs were essentially the same as previously
described for the similar studies of 6-hydroxymethyl-7,8-dihydropterin
pyrophosphokinase using a Spex FluoroMax-2 fluorometer.9,10 Briefly,
proteins and ligands were all dissolved in 100 mM Tris-HCl, pH 8.3,
and the titration experiments were performed in a single cuvette with
a Spex FluoroMax-2 fluorometer at 24 °C. To determine the Kd values
of the binding of 8 and 9 to SaY54F, a 2 mL solution containing 10
Gas Chromatography/Mass Spectrometry (GC/MS) of Glycola-
ldehyde (3). The derivatization protocol is a modified version of a
procedure developed for analysis of plant metabolites,11 with N-(tert-
butyldimethylsilyl)-N-methyltrifluoroacetamide (MTBSTFA) substituted
for N-methyl-N-(trimethylsilyl)trifluoroacetamide as needed to form tert-
(8) Scherperel, G.; Yan, H. G.; Wang, Y.; Reid, G. E. Analyst 2006, 131, 291-
302.
(9) Li, Y.; Gong, Y.; Shi, G.; Blaszczyk, J.; Ji, X.; Yan, H. Biochemistry 2002,
41, 8777-8783.
(10) Shi, G.; Gong, Y.; Savchenko, A.; Zeikus, J. G.; Xiao, B.; Ji, X.; Yan, H.
Biochim. Biophys. Acta 2000, 1478, 289-299.
9
J. AM. CHEM. SOC. VOL. 128, NO. 40, 2006 13217