Structure and specificity of a permissive bacterial C-prenyltransferase

Article abstract of DOI:10.1038/nchembio.2285

This study highlights the biochemical and structural characterization of the L-tryptophan C6 C-prenyltransferase (C-PT) PriB from Streptomyces sp. RM-5-8. PriB was found to be uniquely permissive to a diverse array of prenyl donors and acceptors including

Full text of DOI:10.1038/nchembio.2285

brief communication
puBLIsHed OnLIne: 6 feBruarY 2017 | dOI: 10.1038/nCHeMBIO.2285
structure and specificity of a permissive bacterial
C-prenyltransferase
sherif I elshahawi1,2, Hongnan Cao3, Khaled a shaaban1,2, Larissa V ponomareva1,2,
thangaiah subramanian4, Mark L farman5, H peter spielmann4,6, George n phillips Jr3*,
Jon s thorson1,2* & shanteri singh2,7*
Thisstudyhighlightsthebiochemicalandstructuralcharacteri- (DMATSs)9,10. We proposed a biosynthetic pathway for 2 in which
zation of the L-tryptophan C6 C-prenyltransferase (C-PT) PriB PriB catalyzes C6 C-prenylation of L-Trp as an early initiating step
from Streptomyces sp. RM-5-8. PriB was found to be uniquely (Fig. 1a; Supplementary Fig. 5). To test this hypothesis, N-His6–
permissive to a diverse array of prenyl donors and acceptors PriB (herein referred to as PriB) was heterologously produced in
including daptomycin. Two additional PTs also produced novel Escherichia coli and purified to homogeneity. Analytical-scale reac-
prenylated daptomycins with improved antibacterial activities tions with L-Trp and dimethylallyl pyrophosphate (DMAPP) led to
over the parent drug.
PriB-dependent quantitative conversion to a new prenylated product,
Biocatalysts involved in late-stage natural product (NP) tailoring as detected by HPLC-MS, consistent with the putative function of
modifications (acylation, alkylation, glycosylation and oxidation) are L-Trp C-PT or DMATS (Supplementary Fig. 6). Reaction optimiza-
a centerpiece of a number of successful biocatalytic strategies for tion revealed that PriB displayed relatively broad metal, temperature
non-native modification of complex NP core scaffolds1–3. Within this and pH tolerance (Supplementary Figs. 7 and 8). Preparative-scale
context, microbes from unexplored environments are a rich source reactions and preparative HPLC led to a single prenylated product
for new chemical and biocatalytic diversity4–7. Herein we describe the (80% isolated yield). HR–ESI–MS and NMR (Supplementary Fig. 9;
discovery and characterization of PriB, a permissive L-tryptophan Supplementary Table 2) confirmed the product as 1 (Fig. 1a),
(L-Trp) C6 C-prenyltransferase (C-PT) from the Appalachian thereby validating the C6 C-PT function of PriB. Reminiscent of
Kentucky coal-mine-fire-associated Streptomyces sp. RM-5-8 isolate8. results obtained with the PTs IptA and SAML0654 (refs. 11,12),
Biochemical and structural studies highlight PriB as a highly profi- replacing L-Trp with 6-methyl-Trp (Fig. 1b, 5; a substrate in which
cient and substrate-permissive PT that adopts a substrate-binding the C6 alkylation site is blocked) in the PriB-catalyzed reaction led
orientation distinct from those of most other indole PTs; the anti- to efficient (62% conversion) PriB-catalyzed C7 prenylation (Fig. 1b;
biotic daptomycin (Cubicin; DAP) was noted among the range of Supplementary Figs. 9–11; Supplementary Table 3), highlighting
unique PriB acceptors. The indole C4 C-PT FgaPT2 and reverse C3 the potential for substrate-based modulation of PriB regiospecificity.
C-PT CdpNPT were also capable of prenylation and, in conjunction PriB steady-state kinetic parameters (L-Trp: kcat = 77.7 ± 1.3 min−1,
with PriB, provided three distinct novel C- and N-prenylated Trp1 Km =1.1±0.05μM;DMAPP:kcat =105.6±7.6min−1, Km =2.0±0.35μM)
DAPs. Cumulatively, this study highlights the discovery and char- implicated PriB as being notably proficient among kinetically char-
acterization of a uniquely permissive C-PT and, for the first time, acterized DMATSs (Supplementary Table 4).
extends the demonstrated successful application of L-Trp and indole
PTs to include C- and N-alkylation of complex cyclic peptides.
To further probe PriB substrate specificity, a range of potential
acceptors (Fig. 1b; Supplementary Figs. 10 and 11; Supplementary
Streptomyces sp. RM-5-8 was recently reported to produce two Table 5) and donors (Fig. 1c; Supplementary Figs. 12–16;
distinct metabolite classes that structurally share a rare unsatu- Supplementary Table 6) was evaluated under saturating native
rated hexuronic acid (Fig. 1a, 2–4)8. Whole-genome sequencing donor DMAPP or acceptor L-Trp, respectively. PriB catalyzed pre-
of Streptomyces sp. RM-5-8 led to a draft genome consisting of 259 nylation of Trp analogs, simple indoles and dihydroxynaphthalenes
contigs with a mean size of 36,940 base pairs (bp) and a GC per- previously identified as DMATS substrates9, and also revealed a
centage of 72.1% (Supplementary Results, Supplementary Fig. 1). number of additional acceptors beyond the established scope of
Bioinformatic analysis revealed a single putative PT-encoding gene, DMATSs, including anthranilic acid (28), uniquely functionalized
designated priB, clustered with additional genes spanning a region naphthalenes (24), anthraquinones (23), phenazines (22) and the
of 25.3 kb (GenBank accession number KT895008; Supplementary drug pindolol (20; Visken). PriB is also the first DMATS capable
Figs. 1 and 2; Supplementary Table 1) that encode putative func- of quantitative conversion of both L- and D-Trp. Reminiscent of the
tions consistent with the proposed biosynthesis of 2, including phenolic O-PT SirD capable of C-, N- and S-prenylation13, PriB
a tryptophanase (priA), two cytochrome P450s (priC/D) and two catalyzed mono- and diprenylation of 5-hydroxy-L-Trp (Fig. 1b, 7),
transglycosylases (priE/F). The priB gene was predicted to encode a implicating its potential for O-alkylation. Unlike most other PTs9,
385-amino-acid protein (PriB) that belongs to the αββα aromatic PT PriB displayed flexibility toward longer prenyl donors, including
superfamily (Supplementary Figs. 3 and 4; Supplementary Table 1) geranyl diphosphate (C10; Fig. 1c, 29), farnesyl diphosphate (C15;
and has close homology to dimethylallyltryptophan synthases Fig. 1c, 30) and geranylgeranyl diphosphate (C20; Fig. 1c, 31).
1department of pharmaceutical Sciences, college of pharmacy, university of Kentucky, lexington, Kentucky, uSA. 2center for pharmaceutical Research and
innovation (cpRi), university of Kentucky, lexington, Kentucky, uSA. 3department of biosciences, Rice university, Houston, texas, uSA. 4department of
Molecular and cellular biochemistry, university of Kentucky, lexington, Kentucky, uSA. 5department of plant pathology, university of Kentucky, lexington,
Kentucky, uSA. 6department of chemistry, Markey cancer center, Kentucky center for Structural biology, university of Kentucky, lexington, Kentucky,
uSA. 7present address: department of chemistry and biochemistry, university of oklahoma, norman, oklahoma, uSA. *e-mail: shanteri.singh@ou.edu,
jsthorson@uky.edu or georgep@rice.edu
nature CHeMICaL BIOLOGY | AdvAnce online publicAtion | www.nature.com/naturechemicalbiology
1

NaTuRe CheMiCaL BioLogy dOI: 10.1038/nCHeMBIO.2285
brief communication
a
b
c
Figure 1 | PriB discovery and permissiveness of PriB and other indole PTs. (a) Genome mining revealed the putative locus for the biosynthesis of 2,
including prib. (b,c) Substrate permissiveness of prib. percent conversion (in parentheses) of enzyme reactions containing constant native donor
(dimethylallyl pyrophosphate, dMApp) and variable prenyl acceptors (5–28) (b) or constant native acceptor (l-trp) and variable donors (29–65)
(c) (n = 2; see also Supplementary Figs. 10–16; Supplementary Tables 5–6).
To date, similar donor permissiveness has only been reported for the product 68 (a putative pathway in Supplementary Fig. 25). Given
indolactam V–specific PTs TleC and MpnD14. PriB also catalyzed the distinction between previously reported FgaPT2 and CdpNPT
turnover with 34 farnesyl diphosphate mimetics15 (Supplementary PT regiospecificity and that determined in the context of DAP, the
Figs. 13 and 14; Supplementary Table 6), including phenoxy-, products of preparative-scale FgaPT2 and CdpNPT reactions with
anilino-, phenylsulfanyl- and benzyl-substituted analogs (Fig. 1c, L-Trp were re-evaluated. Consistent with the literature, this analy-
32–65; Supplementary Figs. 15 and 16), in the first example of sis confirmed that FgaPT2 is a catalyst for L-Trp C4 prenylation
PT-catalyzed utilization of diverse non-native farnesyl diphosphate (Supplementary Fig. 26; Supplementary Table 9) and that turnover
surrogates. While both acceptor- and, to a lesser extent, donor- of L-Trp by CdpNPT is poor (yielding insufficient product for charac-
permissive DMATSs have been reported9,13,14, PriB is among the terization). Subsequent antimicrobial susceptibility studies comparing
most proficient and permissive to date.
66–68 to DAP revealed C6- or N-Trp1-prenylation (66 or 67, respec-
Inspired by PriB’s permissiveness, we assessed its potential to tively) to invoke a 6- to 10-fold improvement in antibacterial activity
utilize the more complex structure of DAP16, which contains both (with no apparent change in general cytotoxicity; Supplementary
L-Trp- and anthranilate (28)-related PriB recognition elements. Table 10), implicating increased lipophilicity as a potential contribu-
Analytical-scale reactions using DAP and DMAPP revealed the tor, consistent with previously reported DAP structure–activity rela-
formation of a new product (~11% turnover) consistent with DAP tionship (SAR) studies19. In addition to offering new improved DAP
prenylation, as observed by LC–MS (Fig. 2a; Supplementary Fig. 17). analogs, this discovery sets the stage for the exploration of additional
Similar DAP-based prenylation assays with six other PTs non-native macromolecular peptide- and/or protein-based targets.
(Supplementary Figs. 18 and 19; Supplementary Table 7) revealed
To investigate the structural basis for PriB substrate specificity and
that both FgaPT2 (an indole C4 C-PT17) and CdpNPT (an indole catalysis, the X-ray crystal structures of apo-PriB (PDB ID 5JXM), the
reverse C3 C-PT, originally annotated as an N-PT18) also success- PriB–pyrophosphate binary complex (PDB ID 5K9M) and a PriB–L-
fully catalyzed DAP prenylation (65% and 75% (Supplementary Trp–dimethylallyl S-thiolodiphosphate ternary complex (PDB ID
Figs. 20 and 21) conversion, respectively). Preparative reactions 5INJ) were determined at 1.15, 1.50 and 1.40 Å resolution, respec-
and preparative HPLC led to single prenylated products from the tively (Supplementary Table 11). In a structure reminiscent of the
PriB- and FgaPT2-catalyzed reactions (6% and 15% isolated yield, PT-barrel fold of aromatic and indole PTs20,21 (Supplementary Fig.
respectively). HR–ESI–MS and NMR confirmed the PriB-catalyzed 27), PriB is comprised of a central β-barrel, formed by a cylindrical
product as the 6-C-prenyl-Trp1 DAP (66) and the FgaPT2-catalyzed β-sheet arranged around a solvent-filled core, surrounded by a ring of
product as the N-prenyl-Trp1 DAP (67; Fig. 2a; Supplementary solvent-exposed α-helices. A comparison of apo-PriB to ligand-bound
Figs. 22–24; Supplementary Table 8; Supplementary Note). structures revealed substantial side chain rearrangement (notably,
Interestingly, similar CdpNPT-catalyzed preparative-scale reactions 123° and 34° rotation of Arg108 and Tyr181, respectively) within the
and characterization revealed an inseparable 1:1 mixture (Fig. 2a; active site and the loop regions around the active site upon substrate
54 mg, 70% isolated yield) of 67 and the unusual C3 reverse prenyl binding that were mediated via both key hydrophobic and hydrogen
2
nature CHeMICaL BIOLOGY | AdvAnce online publicAtion | www.nature.com/naturechemicalbiology

NaTuRe CheMiCaL BioLogy dOI: 10.1038/nCHeMBIO.2285
brief communication
challenge to conventional synthetic strategies25. The permissiveness
of PriB (and other PTs) enables complementary synthetic strategies
that might be further enhanced via structure-based engineering.
H
2N
O
a
O
L-Trp1
H
N
NH
O
O
N
H
N
H
CONH2
O
NH
O
O
O
O
NH
COOH
H
N
received 29 June 2016; accepted 1 December 2016;
published online 6 february 2017
N
H
N
H
HOOC
NH
O
O
HO
O
NH
COOH
O
H
O
N
N
H
N
H
O
DAP
Methods
O
L-Kyn13
COOH
NH2
Methods, including statements of data availability and any associated
accession codes and references, are available in the online version
of the paper.
PriB
FgaPT2
CdpNPT
5′
3′
3′
3′
1′
5′
5′
references
7
1′
7
7
1′
7
1. Walsh, C.T. Nat. Chem. Biol. 11, 620–624 (2015).
7a
7a
7a
N
NH
7a
3
N
NH
5
2. Tibrewal, N. & Tang, Y. Annu. Rev. Chem. Biomol. Eng. 5, 347–366 (2014).
3. Gantt, R.W., Peltier-Pain, P. & orson, J.S. Nat. Prod. Rep. 28, 1811–1853 (2011).
4. Elshahawi, S.I. et al. Proc. Natl. Acad. Sci. USA 110, E295–E304 (2013).
5. Ling, L.L. et al. Nature 517, 455–459 (2015).
5
5
5
OH
3a
3a
3a
3′
3a
3
3
3
5′
1′
66
67
67
68
6. Donia, M.S. & Fischbach, M.A. Science 349, 1254766 (2015).
7. Carr, G. et al. Org. Lett. 14, 2822–2825 (2012).
b
8. Wang, X. et al. Org. Lett. 17, 2796–2799 (2015).
K179
R232
9. Fan, A., Winkelblech, J. & Li, S.-M. Appl. Microbiol. Biotechnol. 99,
7399–7415 (2015).
Y181
W165
L110
K234
10. Rudolf, J.D., Wang, H. & Poulter, C.D. J. Am. Chem. Soc. 135, 1895–1902 (2013).
11. Takahashi, S. et al. J. Bacteriol. 192, 2839–2851 (2010).
12. Winkelblech, J. & Li, S.M. ChemBioChem 15, 1030–1039 (2014).
13. Rudolf, J.D. & Poulter, C.D. ACS Chem. Biol. 8, 2707–2714 (2013).
14. Mori, T. et al. Nat. Commun. 7, 10849 (2016).
180°
Y380
H312
E169
R108
Y181
T310
15. Subramanian, T., Liu, S., Troutman, J.M., Andres, D.A. & Spielmann, H.P.
ChemBioChem 9, 2872–2882 (2008).
H312
F220
Y380
T378
R376
L293
16. Eisenstein, B.I., Oleson, F.B. Jr. & Baltz, R.H. Clin. Infect. Dis. 50 (Suppl. 1):
S10–S15 (2010).
17. Unsöld, I.A. & Li, S.-M. Microbiology 151, 1499–1505 (2005).
18. Mahmoodi, N. & Tanner, M.E. ChemBioChem 14, 2029–2037 (2013).
19. Yin, N. et al. J. Med. Chem. 58, 5137–5142 (2015).
20. Kuzuyama, T., Noel, J.P. & Richard, S.B. Nature 435, 983–987 (2005).
21. Bonitz, T., Alva, V., Saleh, O., Lupas, A.N. & Heide, L. PLoS One 6, e27336
(2011).
Figure 2 | Prenylated daptomycins (DaPs) and the crystal structure
of PriB. (a) products of prib-, Fgapt2- and cdpnpt-catalyzed prenylation of
dAp. (b) prib active site residues and corresponding ligand hydrogen bond
interactions (left, front and right, back perspective). the ligands are illustrated
as ball-and-stick models, with the following color code: carbon, green;
oxygen, red; nitrogen, blue; phosphorus, orange; sulfur, yellow; water, red
spheres; and putative hydrogen bonding interactions, dashed brown lines.
22. Tanner, M.E. Nat. Prod. Rep. 32, 88–101 (2015).
23. Williams, G.J., Zhang, C. & orson, J.S. Nat. Chem. Biol. 3, 657–662 (2007).
24. Nobeli, I., Favia, A.D. & ornton, J.M. Nat. Biotechnol. 27, 157–167 (2009).
25. Feng, Y. et al. J. Am. Chem. Soc. 137, 10160–10163 (2015).
bonding interactions (Supplementary Fig. 28). Consistent with a
lack of divalent metal influence on PriB catalysis (Supplementary
Fig. 8), the side chain amines of PriB Arg108 and Lys179 in substrate-
bound PriB occupy the divalent-cation-binding site of correspond-
ing metal-dependent PTs (Fig. 2b)20. PriB substrate orientation in
ligand-bound structures is most similar to that of indole C7 PTs
(MpnD and TleC; both enzymes display broad donor specificity)14
and clearly distinct from that of the corresponding C2 (FtmPT1),
C4 (FgaPT2) or C3 PTs (CdpNPT) (Supplementary Fig. 29)
whereas the DMSPP C1 is located within 3.6 Å of the indole C6 or
C7 in PriB (Supplementary Fig. 28). The unique substrate orienta-
tion within PriB and/or the observed PriB-binding-pocket dynamics
upon substrate binding are potential contributors to the catalyst’s
expanded permissiveness. Similar to other indole PTs22, conserved
aromatic residues (Tyr181, Tyr236 and Tyr380) stabilize the prenyl
carbocation via π–cation interactions, and a conserved glutamic acid
(Glu94) is poised as a general base for indole activation in which the
PriB His312 imidazole may further stabilize indole C6 transition-
state charge density (Supplementary Fig. 28). This histidine is also
conserved in some other indole C6-PTs13 (Supplementary Fig. 27).
In summary, genome mining of a microbe associated with an
Appalachian underground coal-mine fire enabled the discovery and
characterization of the L-Trp C6 C-PT PriB, whose enhanced pro-
ficiency and expanded donor–acceptor substrate permissiveness is
consistent with similar proficiency and permissiveness among other
native or engineered enzymes23,24. As a biocatalyst, PriB is robust,
acknowledgments
This work was supported by NIH grants R37 AI52188 and R01 CA203257 (J.S.T.),
U01 GM098248 (G.N.P.) and NCATS (UL1TR001998). Daptomycin (Cubicin) was
generously provided by Merck. We are grateful to J. Rohr, S. Van Lanen and J. Chappell
(College of Pharmacy, University of Kentucky) for helpful discussion and facilitating
access to shared equipment and/or reagents. We thank the University of Kentucky Mass
Spectrometry Facility for the HR–ESI–MS support. This research also used resources of
the Advanced Photon Source, a US Department of Energy (DOE) Office of Science user
facility operated by Argonne National Laboratory (DE-AC02-06CH11357). Use of the
Lilly Research Laboratories Collaborative Access Team (LRL-CAT) beamline at Sector 31
of the Advanced Photon Source was provided by Eli Lilly and Company.
author contributions
S.I.E. and H.C. contributed to the experimental design and execution and manuscript
preparation; K.A.S. and L.V.P. contributed to experimental design and execution;
T.S. and H.P.S. contributed experimental reagents and consultation; M.L.F. contributed
to experimental design and execution and provided key consultation; G.N.P. and J.S.T.
contributed to the experimental design, project oversight and manuscript preparation;
S.S. contributed to the experimental design and execution, project oversight and
manuscript preparation.
Competing financial interests
The authors declare competing financial interests: details accompany the online version
of the paper.
additional information
Any supplementary information, chemical compound information and source data are
available in the online version of the paper. Reprints and permissions information is
available online at http://www.nature.com/reprints/index.html. Correspondence and
and it catalyzes a reaction (indole C6 alkylation) that remains a requests for materials should be addressed to S.S., J.S.T. or G.N.P.
nature CHeMICaL BIOLOGY | AdvAnce online publicAtion | www.nature.com/naturechemicalbiology
3

oNLiNe MeThoDS
HPLC method G: Gemini C18 (5 μm, 10 × 250 mm) column (Phenomenex)
[10% B for 2 min, gradient of 10% B to 100% B over 13 min, 100% B for 3 min,
100% B to 10% B for 4 min, 10% B for 4 min (A = ddH2O with 0.1% trifluoro-
Strains and materials. Streptomyces sp. RM-5-8 was isolated from the Ruth
Mullins underground coal-mine-fire site and was provided by the University of
Kentucky CPRI Natural Products Repository. All primers were purchased from acetic acid; B = acetonitrile) flow rate: 5.0 ml min−1; A280].
Integrated DNA Technology, E. coli 5α and BL21(DE3) competent cells were
purchased from New England BioLabs. Dimethylallyl S-thiolodiphosphate DNA extraction, genome sequencing and analyses. Streptomyces sp. RM-5-8
(DMSPP) was purchased from Echelon Biosciences. Polyethylene glycol
3350 (PEG 3350) and PEG 4000 both in the form of a 50% w/v solution, as
well as crystallization screens Index HT, PEGRx HT, Crystal Screen HT and
SaltRx HT were obtained from Hampton Research. Crystallization screens
was grown on M2-medium agar (glucose, 4.0 g L−1; Bacto yeast extract, 4.5 g
L−1; Bacto malt extract, 10 g L−1; calcium carbonate, 2.0 g L−1; agar, 17.0 g L−1
)
for four d at 28 °C. Pure colonies were used to inoculate a 250 ml Erlenmeyer
flask containing 50 ml of liquid medium A (soluble starch, 20.0 g L−1; glucose,
JCSG-plus HT-96, Morpheus and MIDAS were from Molecular Dimensions. 10.0 g L−1; Bacto peptone, 5.0 g L−1; Bacto yeast extract, 5.0 g L−1; NaCl, 4.0
All other reagents and chemicals were purchased from Sigma-Aldrich or
g L−1; K2HPO4, 0.5 g L−1; MgSO4 7H2O, 0.5 g L−1; CaCO3, 2.0 g L−1). After 3
•
Fisher Scientific and were used without further purification unless otherwise d of incubation at 28 °C with 200 r.p.m. agitation, the cell pellet was col-
stated. PD-10 columns and Ni-NTA superflow columns were purchased from lected by centrifugation at 5,000 × g for 15 min. Genomic DNA was extracted
GE Healthcare. All non-native synthetic prenyl donors were synthesized as using an UltraClean Microbial DNA Isolation Kit (MoBio laboratories, Inc)
previously reported26,27. All solvents used were of ACS grade and purchased
following the manufacturer’s protocol. DNA quality and concentration were
from Pharmco-Aaper. All DNA sequencing was conducted with the primers assessed using gel electrophoresis and Nanodrop 2000c spectrophotometer
T7 promoter (5′-TAATACGACTCACTATAGGG-3′) and T7 terminator (Thermo Scientific), and purity was confirmed using 16S rRNA analysis. The
(5′-GCTAGTTATTGCTCAGCGG-3′). Daptomycin (DAP, Cubicin) was resultant DNA solution was subjected to massively parallel sequencing using
generously provided by Merck.
MiSeq sequencer (Illumina) at the University of Kentucky Advanced Genetic
Technologies Center (UK-AGTC). The genome (10.5 Mb, 28× coverage) was
General methods. NMR spectra were obtained at ambient temperature assembled using Newbler v.2.9 (Roche Diagnostics). Low-quality regions
on Varian Unity Inova 400, 500 or 600 MHz instruments (University of
Kentucky College of Pharmacy NMR facility) using 99.8% d6-DMSO
were sequence verified by polymerase chain reaction and Sanger sequencing.
Putative prenyltransferase (PT) genes were identified via Basic Local Alignment
(Cambridge Isotope Laboratories) as a solvent. Chemical shifts were refer- Search Tool (BLAST) comparison of the final assembly to a group of 52 fungal
enced to internal solvent resonances and are reported in parts per million and bacterial PT genes (Supplementary Fig. 3). Homology searches of the
(p.p.m.) with coupling constants J given in Hz. Analytical TLC was performed
generated contigs were carried out using the BLASTX and position-specific
on silica gel glass TLC plates (EMD Millipore). Visualization was accom- iterated BLAST (PSI–BLAST). Gene alignments and analyses were performed
plished with UV light (254 nm) followed by staining with vanillin-sulfuric acid
reagent and heating. HPLC was accomplished on an Agilent 1260 HPLC
using Geneious Pro 5.0.3 (ref. 28) (Supplementary Table 1 and Supplementary
Fig. 1). The sequence of the putative pri biosynthetic gene cluster of 2 has been
system equipped with a DAD detector (HPLC methods A, B and C), a Waters deposited under GenBank accession number KT895008.
2695 separation module equipped with a Waters 2996 photodiode array
detector and a Waters Micromass ZQ (methods D and E), or a Varian Prostar Gene cloning and protein production and purification. The priB gene was
210 HPLC system equipped with a photodiode array detector (methods F
amplified from Streptomyces sp. RM-5-8 genomic DNA using the primers
and G). HPLC peak areas were integrated with Varian Star Chromatography PriB-NdeI-F AGGCCATATGGGAGGTCCGATGAGCGGTTTCCA and
Workstation Software and the percent conversion calculated as a per- PriB–HindIII-R TATTAAGCTTTCACAGCCGTGCCCGCGCCCGGTC
cent of the total peak area. High-resolution electrospray ionization (ESI)
(engineered restriction sites underlined). The corresponding fragment was
mass spectra were recorded on an Exactive Orbitrap mass spectrometer cloned into the E. coli expression vector pET28a (Novagen) and confirmed
(Thermo Scientific).
HPLC method A: Luna C18 (5 μm, 4.6 mm × 250 mm) column (Phenomenex)
via sequencing. The validated expression plasmid (pSEPriB) was subsequently
transformed into E. coli BL21 (DE3) competent cells (New England BioLabs).
[10% B for 5 min, gradient of 10% B to 100% B over 18 min, 100% B for 5 min, Production strains for the group of previously reported fungal and bacterial
100% B to 10% B over 1 min, 10% B for 4 min (A = double distilled H2O (ddH2O) PTs were constructed in a similar fashion from synthetic genes (GenScript);
with 0.1% formic acid; B = acetonitrile) flow rate = 1 ml min−1; A280].
HPLC method B: Luna C18 (5 μm, 4.6 mm × 250 mm) column (Phenomenex)
[20% B for 5 min, gradient of 20% B to 100% B over 16 min, 100% B for 7 min,
Supplementary Table 8). All studies employed the corresponding N-terminal-
His6 fusion proteins.
For protein production, 1 L of LB medium (Becton, Dickinson and
100% B to 20% B over 1 min, 20% B for 4 min (A = ddH2O with 0.1% formic Company) supplemented with kanamycin (50 μg ml−1) was inoculated with
acid; B = acetonitrile) flow rate = 1 ml min−1; A280].
HPLC method C: Luna C18 (5 μm, 4.6 mm × 250 mm) column (Phenomenex) at 37 °C with shaking (225 r.p.m.). Cultures were induced at an optical den-
[10% B for 5 min, gradient of 10% B to 100% B over 10 min, 100% B for 13 min, sity at 600 nm (OD600) of ~0.6–0.8 with isopropyl-β-D-thiogalactopyranoside
0.1% (v/v) of an overnight pSEPriB-E. coli BL21 (DE3) seed culture and grown
100% B to 10% B over 1 min, 10% B for 4 min (A = ddH2O with 0.1% formic (IPTG, 0.5 mM final concentration) and allowed to grow for an additional
acid; B = acetonitrile) flow rate = 1 ml min−1; A280].
HPLC method D: Kinetex EVO C18 (5μm, 4.6 mm × 250 mm) column
16 h at 22 °C. Cells were harvested by centrifugation and stored in lysis buffer
(10 mM imidazole, 50 mM sodium monobasic phosphate, 300 mM NaCl,
(Phenomenex) [10% B for 5 min, gradient of 10% B to 100% B over 21 min, pH 8.0) at −80 °C until used. All subsequent steps were carried out on ice.
100% B for 4 min, 100% B to 10% B over 1 min, 10% B for 4 min (A = ddH2O Cells were allowed to thaw and were subsequently lysed by sonication (Virtis
with 0.1% formic acid; B = acetonitrile with 0.1% formic acid) flow rate = VirSonic 475 with a microtip, 100 W, 10 × 10 s pulses, 20 s between pulses).
0.5 ml min−1; A280].
Insoluble debris was removed by centrifugation at 15,000 × g for 1 h. The
HPLC method E: Kinetex EVO C18 (5 μm, 4.6 mm × 250 mm) column supernatant was collected and filtered using 0.22 μm filters and the desired
(Phenomenex) [10% B for 5 min, gradient of 10% B to 100% B over 15 min, N-His6–PriB fusion protein was purified via HiTrap nickel–nitrilotriacetic
100% B for 10 min, 100% B to 10% B over 1 min, 10% B for 4 min (A = ddH2O acid (Ni–NTA) affinity chromatography using standard protocols with AKTA
with 0.1% formic acid; B = acetonitrile with 0.1% formic acid) flow rate = Purifier 10 (GE Healthcare). Buffer exchange of each sample was performed
0.5 ml min−1; A280].
HPLC method F: Supelco Discovery Bio wide pore C18 (10 μm, 250 × 21.2 mm)
using a PD-10 column (GE Healthcare) eluted with 50 mM Tris, 100 mM
NaCl, pH 8.0 to yield 5 mg L−1 PriB. Fractions were collected and concentrated
column (Sigma-Aldrich) [10% B for 5 min, gradient of 10% B to 100% B using Amicon Ultra Centrifuge columns 30,000 MWCO (EMD Millipore) and
over 15 min, 100% B for 10 min, 100% B to 10% B over 1 min, 10% B for stored in 50 mM Tris, 100 mM NaCl, pH 8.0 at −80 °C. Protein concentrations
4 min (A = ddH2O with 0.05% formic acid; B = acetonitrile) flow rate = 8 ml were determined by Bradford assay (Bio-Rad) using bovine serum albumin as
min−1; A280].
a standard. Purity and presence of proteins were confirmed by SDS–PAGE gel
nature CHeMICaL BIOLOGY
doi:10.1038/nchembio.2285

electrophoresis. The N-His6-PriB fusion protein (referred to as PriB) was used 1 mM DMAPP and 1 μM enzyme (PriB, FgaPT2 or CdpNPT) in 50 μl Tris
for all studies. Production of other PTs for the overall study (Supplementary (pH 8.0) were incubated for 12 h at 37 °C. FgaPT2- and CdpNPT-catalyzed
Table 8) followed the same protocol.
reactions also contained divalent cation (10 mM CaCl2). Reactions were
terminated by mixing with equal volume of MeOH, centrifuged to remove
Analytical assays and enzyme kinetics. Standard PriB in vitro assays were con- precipitated protein and dried under reduced pressure. Crude reaction mix-
ducted in 1.5 ml tubes in a volume of 100 μl Tris 50 mM (pH 8.0) containing a tures were subsequently redissolved in MeOH and purified via preparative
final concentration of 0.5 mM L-Trp, 1 mM DMAPP, and 250 nM PriB. After HPLC (method G).
pre-incubation of the reaction mixture at 37 °C for 10 min, the reactions were
initiated by the addition of enzyme and allowed to proceed for 60 min (unless
6-C-prenyl-Trp1 DAP (66). White solid (0.6 mg, 6% isolation yield); (−)-ESI–
MS: m/z 1687 [M − H]−; (−)-HR–ESI–MS: m/z 1686.7635 [M − H]− (calculated
otherwise noted) at 37 °C. The reactions were quenched by the addition of for C77H108N17O26, 1686.7657). 1H NMR (d6-DMSO, 600 MHz) and 13C NMR
100 μl MeOH and mixing followed by centrifugation (22,000 × g, 15 min, 4 °C) (d6-DMSO, 150 MHz); see Supplementary Figures 22–24, Supplementary
to remove precipitated protein. The supernatants were analyzed by HPLC using Table 8; Supplementary Note.
method A (see “General methods”) to calculate conversion rate based on the
N-prenyl-Trp1 DAP (67). White solid (6 mg, 60% isolation yield);
area of substrate and the prenylated product peaks. When applicable, subse- (−)-ESI-MS: m/z 1687 [M − H]−; (−)-HR-ESI-MS: m/z 1686.7603 [M − H]−
quent product mass analyses (Supplementary Tables 5 and 6; Supplementary (calculated for C77H108N17O26, 1686.7657); (+)-HR–ESI–MS: m/z 1688.7870
Note) were typically accomplished via direct LC–MS (LC–ESI–MS, method D
[M + H]+ (calculated for C77H110N17O26, 1688.7802); 1H NMR (d6-DMSO,
or E, see “General methods”) and/or HR–ESI–MS of HPLC-purified products 400 MHz) and 13C NMR (d6-DMSO, 100 MHz); see Supplementary Figures
(method A).
22–24, Supplementary Table 8; Supplementary Note.
Temperature optimization. Replicates of the standard assay were conducted
at 4, 10, 20, 30, 37, 45, 55, 65 °C.
CdpNPT prenylated daptomycin mixture (67/68). White solid (53 mg,
70% isolation yield, mixture 1:1); (−)-ESI–MS: m/z 1687 [M − H]−; (−)-HR–
pH optimization. Replicates of the standard assay were modified via substitu- ESI–MS: m/z 1686.7655 [M − H]− and [(M − H2O) − H]− (calculated
tion of Tris 50 mM (pH 8.0) with 50 mM citric acid–sodium dihydrogen phos- for C77H108N17O26, 1686.7657); 1H NMR (d6-DMSO, 400 MHz) and 13C NMR
phate (pH 3.5–8.0) or 50 mM glycine–sodium hydroxide (pH 8.5–11.0).
Various cation assessment. Replicates of the standard assay were conducted Table 8; Supplementary Note.
in the presence of 5 or 10 mM of each of the following: EDTA, MgCl2, CuCl2,
(d6-DMSO, 100 MHz); see Supplementary Figures 22–24; Supplementary
MnCl2, LiCl, BaCl2, CoCl2, CaCl2, ZnCl2, and SrCl2.
Bioactivity assays. All DAP and DAP analog stocks were calibrated by
absorbance (ε366 = 4,000 L mol−1 cm−1) (ref. 29) and all bioactivity assays were
Determination of kinetic parameters. Replicates of the standard assay were
used with variable acceptor ([L-Trp] = 1 × 10−3–5 mM) and fixed donor conducted in triplicate. Antimicrobial activities were determined by follow-
([DMAPP] = 1 mM) or variable donor ([DMAPP] = 0.5–4 mM) and fixed
ing a previously reported protocol30. Strain growth also followed our prior
acceptor ([L-Trp] = 0.5 mM) in triplicate. The kinetic constants were calculated protocol30 in which LB medium (BD244620) was used for Bacillus subtilis and
by nonlinear regression fit to the Michaelis–Menten equation using GraphPad
Prism 7 software.
Middlebrook 7H9 with OADC enrichment (Sigma-Aldrich) for Mycobacterium
aurum. Cancer cell line cytotoxicity assays as a measure of general eukaryotic
cell toxicity employed the human lung nonsmall-cell carcinoma cell line A549
PriB substrate specificity. Replicate assays were performed with 0.5 mM
acceptor and 0.3–2 mM donor in the presence of 2 μM purified PriB in as previously reported30.
50 mM Tris pH 8.0 for 16 h.
Daptomycin catalyst survey. Replicates assays contained 1 μM enzyme, Crystallization, diffraction data collection, and structure determination
1 mM DAP, and 1 mM DMAPP in the presence of 50 mM Tris (pH 8.0). Assays of PriB. PriB from Ni-affinity chromatography was further purified via gel
containing FgaPT2 or CdpNPT were supplemented with 10 mM CaCl2.
filtration (Superdex 200; 50 mM Tris pH 7.5 buffer, 100 mM NaCl) via an
AKTAprime Plus FPLC system (GE Healthcare), concentrated with Amicon
Ultra-4 Centrifugal Filter Units (EMD Millipore) to a final concentration of
34 mg ml−1, drop flash-frozen and stored at −80 °C before use. Initial crystal-
lization trials were set up by mosquito Crystal nanoliter dispenser robot (TTP
Prenylated L-Trp product isolation/characterization. For isolation and full
characterization of prenylated Trp analogs, 0.5 ml reactions (×20) in 1.5 ml
Eppendorf tubes containing 2.5 mM acceptor (L-Trp or 6-methyl-DL-Trp),
2.5 mM DMAPP, 5 μM enzyme (PriB or FgaPT2) in 50 mM Tris (pH 8.0) Labtech) on MRC 2 Well crystallization plates (Hampton Research) using sit-
were incubated for 16 h at 37 °C. Divalent cation (10 mM CaCl2) was also ting drop vapor-diffusion method testing against all seven commercial high-
included in all FgaPT2-catalyzed reactions. Reactions were combined, termi- throughput screens each with 96 conditions. PriB was crystallized by sitting
nated by mixing with equal volume of MeOH, centrifuged to remove precipi- drop vapor diffusion using a 1:1 v/v mixing of 10 mg ml−1 PriB solution in the
tated protein and dried under reduced pressure. The crude reaction mixture
was redissolved in MeOH and purified via preparative HPLC (Method F).
4-dimethylallyl-L-Trp (70). White solid (5.6 mg, 56% isolation yield);
presence of 1 mM L-Trp with reservoir solution containing 0.1 M Tris, pH 8.5,
20% w/v PEG 3350, 0.1 M MgCl2. The mixed drops of 0.4–1 μl were equilibrated
over a reservoir solution of 50 μl and incubated at 20 °C in the dark. Monoclinic
(+)-ESI–MS: m/z 273 [M + H]+; (+)-HR–ESI–MS: m/z 273.1596 [M + H]+ shaped crystals grew after 6–10 d with the longest dimension typically reaching
(calculated for C16H20N2O2, 273.1598). 1H NMR (d6-DMSO, 400 MHz) and 13
C
100–600 μm. The iodine derivative was prepared by soaking a solution of 0.5 M
NMR (d6-DMSO, 100 MHz); see Supplementary Figure 26; Supplementary sodium iodide, 50 mM Tris pH 8.5, 10% w/v PEG 3350, 0.05 M MgCl2 into
Table 9; Supplementary Note.
a drop of PriB crystals (grown under the same condition as the apo form) at
a 1:3 v/v mixing ratio. The ternary complex was obtained by soaking a solution
6-dimethylallyl-L-Trp (1). White solid (8 mg, 80% isolation yield); (+)-ESI–
MS: m/z 273 [M + H]+; (+)-HR–ESI–MS: m/z 273.1598 [M + H]+ (calculated of 25 mM substrate mimic dimethylallyl S-thiolodiphosphate (DMSPP), 50 mM
for C16H20N2O2, 273.1598). 1H NMR (d6-DMSO, 400 MHz) and 13C NMR Tris, pH 8.5, 10% w/v PEG 3350, 0.05 M MgCl2 into PriB crystals (grown under
(d6-DMSO, 100 MHz); see Supplementary Figure 9; Supplementary
Table 2; Supplementary Note.
conditions similar to the native form in the presence of substrate 1 mM L-Trp
at pH 8.0) at a 1:1.5 v/v mixing ratio. The product diphosphate-bound form
was obtained by growing PriB crystals using the same sitting drop procedure
6-methyl-7-dimethylallyl-L-Trp (69). White solid (6 mg, 15% isolation yield);
(+)-ESI–MS: m/z 287 [M + H]+; (+)-HR–ESI–MS: m/z 287.1753 [M + H]+ but under different conditions by 1:1 v/v mixing of 10 mg ml−1 PriB solution
(calculated for C17H23N2O2, 287.1754). 1H NMR (d6-DMSO, 400 MHz) and 13
NMR (d6-DMSO, 100 MHz); see Supplementary Figure 9; Supplementary cin with reservoir conditions containing 100 mM Tris, pH 8.0, 28% w/v PEG
C
in the presence of 1 mM of each of dimethylallyl diphosphate and daptomy-
Table 3; Supplementary Note.
4000. Crystals of the native form and ternary complex were cryoprotected by
transferring into MiTeGen’s LV CryoOil (MiTeGen) and flash-frozen in liquid
Prenylated DAP product isolation and characterization. For isolation and full nitrogen. The crystal of the diphosphate complex was directly flash frozen in
characterization of prenylated DAP analogs, reactions containing 1 mM DAP,
liquid nitrogen without additional cryoprotectant.
nature CHeMICaL BIOLOGY
doi:10.1038/nchembio.2285

Diffraction data were collected at the Advanced Photon Source at Argonne
limits as in data collection with favorable Rcryst and Rfree values (Supplementary
National Laboratory on the LRL-CAT (31-ID-D) beamline. The detector used Table 11). Model quality was assessed using MolProbity35. Ramachandran
was a Rayonix 225 HE CCD (Rayonix) using a single wavelength of 1.3776 Å statistics determined as the percentage of residues were 98.9, 1.1, 0.0 in the
for the iodine derivative and 0.97931 Å for all other data sets. The anomalous most favored, additionally allowed and outlier regions of the Ramachandran
data set was collected and processed to a resolution of 1.54 Å, the apo form to diagram, respectively. All structures were rendered using PyMOL35.
1.15 Å, the ternary complex to 1.4 Å, and the diphosphate complex to 1.5 Å
(Supplementary Table 11). The anomalous and apo data sets were indexed, Data availability. Nucleotide sequence data for the pri cluster is available
integrated, and scaled using XDS31. The substrate/product complexes data
under GenBank accession code KT895008. The PriB X-ray crystal struc-
sets were indexed and integrated by MOSFLM, scaled and merged by SCALA tures were deposited at the Protein Data Bank: the PriB–L-Trp–dimethylallyl
from the CCP4 program suites32. The structure of PriB was determined by
S-thiolodiphosphate ternary complex (5INJ), the apo structure (5JXM), and
single-wavelength anomalous diffraction (SAD) phasing on the iodine deriva- the PriB–pyrophosphate binary complex (5K9M). All other data generated or
tive data set using AutoSol from the PHENIX software suite33. One copy of analyzed during this study are included in this published article (and its sup-
the polypeptide was found and built in the asymmetric unit with 26 iodine plementary information files) or are available from the corresponding author
atoms of various occupancy. The sparsity of intermolecular contacts (largest
interface area <530 Å2) in the crystal packing suggest the protein is a monomer.
Analysis of crystal contact suggests the protein to be a monomer. The protein
model as traced from the iodide containing data set was then used as the search
model for solving the apo and ligand complexes by molecular replacement
with Phaser_MR and Autobuild of the PHENIX suite33. Most of the amino
acid residues were successfully built with traceable electron density except
for short stretches at the N and C termini, as well as one short flexible loop
away from the active site. Ligands and alternative conformations of residues
were built into the model based on difference electron density maps. The
structures were completed with alternating rounds of manual model building
with COOT34 and refinement with PHENIX. Water was added and updated
during refinement. The final structures were refined to the same resolution
on reasonable request.
26. Chehade, K.A.H. et al. J. Am. Chem. Soc. 124, 8206–8219 (2002).
27. Subramanian, T., Wang, Z., Troutman, J.M., Andres, D.A. & Spielmann, H.P.
Org. Lett. 7, 2109–2112 (2005).
28. Kearse, M. et al. Bioinformatics 28, 1647–1649 (2012).
29. Debono, M. et al. J. Antibiot. (Tokyo) 41, 1093–1105 (1988).
30. Shaaban, K.A. et al. J. Nat. Prod. 78, 1723–1729 (2015).
31. Kabsch, W. Acta Crystallogr. D Biol. Crystallogr. 66, 125–132 (2010).
32. Collaborative Computational Project, Number 4. Acta Crystallogr. D Biol.
Crystallogr. 50, 760–763 (1994).
33. Adams, P.D. et al. Acta Crystallogr. D Biol. Crystallogr. 66, 213–221 (2010).
34. Emsley, P., Lohkamp, B., Scott, W.G. & Cowtan, K. Acta Crystallogr. D Biol.
Crystallogr. 66, 486–501 (2010).
35. Chen, V.B. et al. Acta Crystallogr. D Biol. Crystallogr. 66, 12–21 (2010).
nature CHeMICaL BIOLOGY
doi:10.1038/nchembio.2285