Illarionov et al.
TABLE 5. Oligon u cleotid es Used in Th is Stu d y
primer
restriction site
codon replacement
primer sequencea
RO 1
RO 2
BS-L
BS-R
BS-M
BamHI
HindIII, SpeI, BstBI
no
no
no
no
no
no
5′-GAGGATCCGGGCTTTTTTGACGGTAAATAACAAAAG
5′-GAGAAGCTT ACTAGT ATTTCGAACCGTGAACAGCTGAACCGCC
5′-TTGGCACAGTGAAAGCCGACAATCC
5′-CTTTTCTCTTCAATTCGTGTGATTTCCGCA
5′-GGATGGTGATCATGGCTACAGGAATTATCGAAGAA
BclI
F2 f A
a
Codon specifying modified amino acid residue is shown in bold. Synthetic restriction sites are underlined.
medium34 supplemented with vitamins, trace elements, and
of glucose or other carbon sources can be similarly applied
to a wide variety of other natural products.
ampicillin (50 mg per liter), as well as 13C-labeled glucose (4
g/L) and/or 15NH4Cl (2 g/L). The suspensions were incubated
at 37 °C with shaking. Aliquots of bacterial cultures were
retrieved at intervals for HPLC analysis. After incubation for
13 h, cell suspensions were centrifuged; the cells were dis-
carded.
Exp er im en ta l Section
Ma ter ia ls. All materials were purchased from commercial
suppliers.
Isola tion of 6,7-Dim eth yl-8-r ibityllu m a zin e (6). Super-
natants of bacterial cultures (see above) were passed through
columns of Florisil (1 × 1.5 cm), which were then washed with
10 mL of water and developed with 5 mL of ammonium
hydroxide/acetone/water (1:250:250, v/v). Eluates were evapo-
rated to a small volume under reduced pressure and were then
lyophilized. The residue was dissolved in 2 mL of 50 mM
hydrochloric acid and applied to a column of Hypersil RP 18
(20 × 250 mm), which was developed with a mixture of
methanol/formic acid/water (25:1:288, v/v). The retention
volume of 6,7-dimethyl-8-ribityllumazine (6) was 160 mL.
Ba cter ia l Str a in s a n d P la sm id s. Bacterial strains and
plasmids used in this work are shown in Table 4. A 885 bp
DNA segment was amplified by PCR using the oligonucleotides
RO1 and RO2 as primers (Table 5) and the plasmid pRF2 as
template (Table 4). The amplificate was digested with BamHI
and HindIII and was ligated into plasmid pNCO113, which
had been digested with the same restriction enzymes. The
resulting plasmid pRFN1 was transformed into E. coli XL1
blue.
Treatment of plasmid pRF2 with BsiWI and XbaI afforded
a 4.5 kbp DNA fragment, which was ligated into the pRFN1
plasmid that had been digested with BsiWI and NheI. The
resulting plasmid pRFN2 was transformed into E. coli strain
XL1-blue affording the recombinant strain E. coli XL1-blue
[pRFN2].
Treatment of the plasmid p602/-CAT with XhoI and EcoRI
afforded a 190 bp fragment that was isolated and was then
ligated into the plasmid pRFN2, which had been treated with
the same restriction enzymes. The resulting plasmid pRFN3
was transformed into E. coli strain XL1-blue affording the
recombinant strain E. coli XL1-blue [pRFN3].
A DNA segment of 360 bp was amplified using the oligo-
nucleotides BS-R and BS-M as primers (Table 5) and the
plasmid pRFN3 as template. A second PCR round was then
performed with the oligonucleotides BS-R and BS-L as prim-
ers. The amplificate was treated with SalI and PstI and was
then ligated into the plasmid pRFN3, which had been treated
with the same restriction enzymes. The resulting plasmid
pRFN4 was transformed into E. coli strain M15[pREP4]
affording strain M15[pREP4, pRFN4].
HP LC. Analytical high performance liquid chromatography
was performed with an RP18 column (5 µm, 4 × 250 mm),
which was developed with a mixture of methanol/formic acid/
water (25:1:288, v/v). The flow rate was 1.5 mL min-1. The
effluent was monitored photometrically at 408 and 470 nm.
1
NMR Sp ectr oscop y. H, 13C, and 15N NMR spectra were
recorded at 25 °C using a spectrometer equipped with four
channels and a pulsed gradient unit. The transmitter fre-
quencies were 500.1, 125.6 and 50.68 MHz for 1H, 13C, and
15N, respectively. Samples were dissolved in a H2O/D2O mix-
ture (9:1; v/v). Two-dimensional COSY, HMQC, HMBC, and
INADEQUATE experiments were performed according to
standard Bruker software (XWINNMR).
Deter m in a tion of 13C En r ich m en ts. 13C-Enrichments
were determined by quantitative NMR spectroscopy.35 For this
purpose, 13C NMR spectra of 6 from the experiments with the
13C-labeled glucose specimens and of 6 with natural 13C
abundance (i.e., with 1.1% 13C abundance) were measured
under the same experimental conditions. The ratios of the
signal integrals of the biolabeled compound and of the com-
pound at natural abundance were then calculated for each
respective carbon atom. Absolute 13C abundances for certain
carbon atoms (i.e., for carbon atoms with at least one attached
hydrogen atom displaying a 1H NMR signal in a noncrowded
region of the spectrum) were then determined from the 13C
coupling satellites in the 1H NMR spectra. The relative 13C
abundances determined for all other positions in 6 were then
referenced to this value, thus affording absolute 13C abun-
dances for every single carbon atom (% 13C in Table 3).
Ba cter ia l Cu ltu r e. Recombinant E. coli strains were grown
overnight at 37 °C in shaking flasks containing 100 mL of LB
medium34 supplemented with 50 mg of ampicillin and 15 mg
of kanamycin per liter. Cells were collected by centrifugation
(5000g, 4 °C, 10 min) and were resuspended in 0.8 L of M9
(26) Bacher, A.; Mailander, B. J . Bacteriol. 1978, 134, 476-482.
(27) Le Van, Q.; Keller, P. J .; Bown, D. H.; Floss, H. G.; Bacher, A.
J . Bacteriol. 1985, 162, 1280-1284.
(28) Neuberger, G.; Bacher, A. Biochem. Biophys. Res. Commun.
1986, 139, 1111-1116.
(29) Bacher, A.; Richter, G.; Ritz, H.; Eberhardt, S.; Fischer, M.;
Krieger, C. Methods Enzymol. 1997, 280, 382-389.
(30) Bacher. A.; Eberhardt, S.; Fischer, M.; Mortl, S.; Kis, K.;
Kugelbrey, K.; Scheuring, J .; Schott, K. Methods Enzymol. 1997, 280,
389-399.
J O0493222
(34) Molecular Cloning: A Laboratory Manual, 2nd ed.; Sambrook,
J ., Fritsch, E. M., Maniatis, T., Eds.; Cold Spring Harbor Laboratory
Press: Cold Spring Harbor, NY, 1989; p A.1.
(35) Eisenreich, W.; Bacher, A. In Genetic Engineering, Principles
and Methods; Setlow, J . K., Ed.; Kluwer Academic/Plenum Publisher:
New York, 2000; Vol. 22, pp 121-153.
(31) Zamenhof, P. J .; Villarejo, M. J . Bacteriol. 1972, 110, 171-178.
(32) Stu¨ber, D.; Matile, H.; Garotta, G. Immunol. Methods 1990, 4,
121-129.
(33) Mo¨rtl, S.; Fischer, M.; Richter, G.; Tack, J .; Weinkauf, S.;
Bacher, A. J . Biol. Chem. 1996, 271, 33201-33207.
5594 J . Org. Chem., Vol. 69, No. 17, 2004